Incidental Mutation 'R7438:Dsg4'
ID 576787
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Name desmoglein 4
Synonyms CDHF13, lah
MMRRC Submission 045514-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.507) question?
Stock # R7438 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 20569232-20604878 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 20599685 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 767 (R767Q)
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
AlphaFold Q7TMD7
Predicted Effect probably damaging
Transcript: ENSMUST00000019426
AA Change: R767Q

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: R767Q

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Meta Mutation Damage Score 0.1437 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 T C 14: 118,853,858 (GRCm39) S425G probably benign Het
Adam29 A G 8: 56,324,609 (GRCm39) I615T probably damaging Het
Arap2 A T 5: 62,906,818 (GRCm39) I67N probably damaging Het
Asxl2 C T 12: 3,477,108 (GRCm39) probably benign Het
Atp13a4 C T 16: 29,260,014 (GRCm39) G607D Het
Atp2c2 G A 8: 120,474,936 (GRCm39) V514M probably damaging Het
Baiap3 A G 17: 25,468,082 (GRCm39) C311R possibly damaging Het
Becn1 A C 11: 101,185,052 (GRCm39) S137R probably benign Het
C1qtnf6 G T 15: 78,409,574 (GRCm39) T91K probably benign Het
C8a T C 4: 104,718,626 (GRCm39) K110E probably damaging Het
Camta2 A G 11: 70,574,714 (GRCm39) probably null Het
Capn8 T A 1: 182,426,240 (GRCm39) Y192N probably damaging Het
Ccdc170 C T 10: 4,508,512 (GRCm39) Q579* probably null Het
Cenpa G T 5: 30,824,292 (GRCm39) probably benign Het
Cltc A G 11: 86,616,054 (GRCm39) V404A probably benign Het
Cyp3a11 A T 5: 145,802,710 (GRCm39) L261Q probably benign Het
Daw1 T A 1: 83,170,436 (GRCm39) S249R probably benign Het
Dchs1 T A 7: 105,404,155 (GRCm39) I2796F probably benign Het
Dis3l2 T C 1: 86,673,222 (GRCm39) probably null Het
Dnah5 A T 15: 28,347,098 (GRCm39) D2527V probably damaging Het
Edaradd A G 13: 12,493,338 (GRCm39) I118T probably damaging Het
Fam83h A G 15: 75,876,275 (GRCm39) F354S possibly damaging Het
Fat3 A G 9: 15,899,778 (GRCm39) V3085A probably benign Het
Fer A G 17: 64,440,516 (GRCm39) D711G possibly damaging Het
G6pc1 G T 11: 101,267,503 (GRCm39) V318F probably benign Het
Gal3st1 C A 11: 3,948,227 (GRCm39) H145N probably benign Het
Helz C T 11: 107,552,856 (GRCm39) P1211S probably damaging Het
Herc1 A G 9: 66,302,038 (GRCm39) I667V probably benign Het
Herc2 T A 7: 55,753,466 (GRCm39) probably null Het
Hivep1 C T 13: 42,308,387 (GRCm39) T209I probably damaging Het
Hsph1 A G 5: 149,542,485 (GRCm39) Y678H probably damaging Het
Ift122 C T 6: 115,903,263 (GRCm39) R1176C probably benign Het
Ighv1-23 T C 12: 114,728,095 (GRCm39) D109G probably damaging Het
Itgb3 T C 11: 104,534,403 (GRCm39) V420A possibly damaging Het
Kcnk13 C A 12: 100,027,985 (GRCm39) N353K probably damaging Het
Kif21a A G 15: 90,877,999 (GRCm39) F270L probably benign Het
Kit T A 5: 75,799,660 (GRCm39) V464D probably benign Het
Klhl36 G A 8: 120,596,914 (GRCm39) W205* probably null Het
Krt17 A G 11: 100,149,291 (GRCm39) Y260H probably damaging Het
Lats1 C T 10: 7,588,706 (GRCm39) Q1108* probably null Het
Lrch1 G A 14: 74,994,477 (GRCm39) T709I possibly damaging Het
Lrrc58 C A 16: 37,689,053 (GRCm39) Q66K probably benign Het
Mei1 G A 15: 81,999,682 (GRCm39) A664T Het
Mtmr6 C T 14: 60,537,753 (GRCm39) T546M probably benign Het
Ncoa3 T A 2: 165,910,449 (GRCm39) F1288L probably damaging Het
Nwd1 G T 8: 73,434,458 (GRCm39) V1352L probably benign Het
Or4k77 T A 2: 111,199,707 (GRCm39) H243Q probably damaging Het
Or5ac17 A T 16: 59,036,761 (GRCm39) C72S probably benign Het
Ovol3 C T 7: 29,934,646 (GRCm39) probably null Het
Palb2 C A 7: 121,716,554 (GRCm39) V843L probably damaging Het
Pds5a T A 5: 65,809,878 (GRCm39) probably null Het
Per1 A G 11: 68,995,561 (GRCm39) S714G possibly damaging Het
Plch2 G A 4: 155,084,917 (GRCm39) R442C probably damaging Het
Pon2 A T 6: 5,289,080 (GRCm39) S26R probably benign Het
Ppp1r9a A T 6: 5,115,378 (GRCm39) N834Y probably damaging Het
Pramel22 T C 4: 143,382,130 (GRCm39) I189V probably damaging Het
Rbm46 C T 3: 82,749,795 (GRCm39) W483* probably null Het
Rnd1 A T 15: 98,571,782 (GRCm39) V88E probably damaging Het
Sbno2 T A 10: 79,905,409 (GRCm39) T142S unknown Het
Scn9a C T 2: 66,377,531 (GRCm39) V384M possibly damaging Het
Sertad4 T A 1: 192,529,018 (GRCm39) H266L possibly damaging Het
Setd5 T A 6: 113,092,043 (GRCm39) M288K possibly damaging Het
Sfxn4 T A 19: 60,845,799 (GRCm39) N66Y probably damaging Het
Sinhcaf A G 6: 148,834,600 (GRCm39) Y10H probably benign Het
Skint6 T A 4: 113,095,425 (GRCm39) N78I probably damaging Het
Sltm G T 9: 70,480,748 (GRCm39) G200V unknown Het
Smg1 A G 7: 117,795,116 (GRCm39) I477T unknown Het
Supv3l1 C T 10: 62,266,249 (GRCm39) probably null Het
Syne2 A G 12: 76,062,337 (GRCm39) R4220G probably benign Het
Tbr1 A T 2: 61,635,161 (GRCm39) H37L possibly damaging Het
Tet3 TGGCCCAGGCCCAGGC TGGCCCAGGCCCAGGCCCAGGC 6: 83,345,211 (GRCm39) probably benign Het
Tmem231 G T 8: 112,645,040 (GRCm39) S155R probably damaging Het
Trem3 A G 17: 48,565,498 (GRCm39) *184W probably null Het
Trim33 T A 3: 103,253,956 (GRCm39) probably benign Het
Tsen2 G A 6: 115,536,943 (GRCm39) W233* probably null Het
Ttc21a T A 9: 119,774,605 (GRCm39) N286K probably damaging Het
Tulp4 A T 17: 6,248,983 (GRCm39) M194L probably benign Het
Ube3b C A 5: 114,553,345 (GRCm39) R906S possibly damaging Het
Ube3b A C 5: 114,556,687 (GRCm39) D1006A probably damaging Het
Vipas39 A T 12: 87,288,705 (GRCm39) probably null Het
Wdr35 T A 12: 9,072,785 (GRCm39) Y920N probably damaging Het
Zan T G 5: 137,423,824 (GRCm39) I2692L unknown Het
Zfp142 C A 1: 74,624,679 (GRCm39) E48D probably benign Het
Zfp598 T C 17: 24,896,504 (GRCm39) Y194H probably damaging Het
Zfp85 T C 13: 67,897,064 (GRCm39) N336S probably benign Het
Zfyve27 A T 19: 42,177,959 (GRCm39) probably null Het
Zp3 T C 5: 136,011,559 (GRCm39) S126P probably damaging Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20,594,383 (GRCm39) missense probably benign 0.22
IGL01723:Dsg4 APN 18 20,599,567 (GRCm39) missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20,594,361 (GRCm39) missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20,579,307 (GRCm39) splice site probably benign
IGL02553:Dsg4 APN 18 20,595,577 (GRCm39) missense probably benign
IGL02578:Dsg4 APN 18 20,604,250 (GRCm39) missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20,591,637 (GRCm39) missense probably benign 0.01
IGL02677:Dsg4 APN 18 20,597,933 (GRCm39) missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20,604,553 (GRCm39) missense probably benign
IGL02747:Dsg4 APN 18 20,579,995 (GRCm39) missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20,584,880 (GRCm39) missense probably damaging 1.00
burrito UTSW 18 20,584,919 (GRCm39) missense possibly damaging 0.81
woodshed UTSW 18 20,584,929 (GRCm39) nonsense probably null
R0043:Dsg4 UTSW 18 20,586,029 (GRCm39) missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20,603,936 (GRCm39) missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20,591,628 (GRCm39) missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20,594,416 (GRCm39) missense probably benign 0.00
R0622:Dsg4 UTSW 18 20,582,845 (GRCm39) missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20,587,703 (GRCm39) splice site probably benign
R0786:Dsg4 UTSW 18 20,582,429 (GRCm39) critical splice donor site probably null
R1114:Dsg4 UTSW 18 20,599,540 (GRCm39) missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20,579,929 (GRCm39) nonsense probably null
R1372:Dsg4 UTSW 18 20,582,733 (GRCm39) splice site probably null
R1382:Dsg4 UTSW 18 20,598,181 (GRCm39) missense probably benign 0.00
R1392:Dsg4 UTSW 18 20,579,304 (GRCm39) splice site probably benign
R1442:Dsg4 UTSW 18 20,595,717 (GRCm39) missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20,582,736 (GRCm39) missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20,604,646 (GRCm39) missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20,595,518 (GRCm39) nonsense probably null
R1765:Dsg4 UTSW 18 20,589,888 (GRCm39) missense probably benign 0.01
R1817:Dsg4 UTSW 18 20,604,302 (GRCm39) missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20,604,269 (GRCm39) missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20,599,693 (GRCm39) nonsense probably null
R2097:Dsg4 UTSW 18 20,604,101 (GRCm39) missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20,594,499 (GRCm39) missense probably benign
R3551:Dsg4 UTSW 18 20,584,813 (GRCm39) missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20,604,058 (GRCm39) missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20,582,291 (GRCm39) missense probably benign
R3955:Dsg4 UTSW 18 20,582,432 (GRCm39) splice site probably null
R4006:Dsg4 UTSW 18 20,604,022 (GRCm39) missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20,584,919 (GRCm39) missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20,591,636 (GRCm39) nonsense probably null
R4254:Dsg4 UTSW 18 20,604,595 (GRCm39) missense probably benign 0.07
R4504:Dsg4 UTSW 18 20,594,493 (GRCm39) missense probably benign 0.00
R4559:Dsg4 UTSW 18 20,603,978 (GRCm39) missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20,604,302 (GRCm39) missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20,595,470 (GRCm39) missense probably benign 0.10
R4683:Dsg4 UTSW 18 20,594,466 (GRCm39) missense probably benign
R4700:Dsg4 UTSW 18 20,589,965 (GRCm39) missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20,579,888 (GRCm39) missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20,604,184 (GRCm39) missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20,599,678 (GRCm39) missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20,579,896 (GRCm39) missense probably benign 0.21
R5426:Dsg4 UTSW 18 20,591,541 (GRCm39) missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20,595,549 (GRCm39) nonsense probably null
R5982:Dsg4 UTSW 18 20,598,226 (GRCm39) missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20,599,724 (GRCm39) missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20,582,847 (GRCm39) missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20,604,420 (GRCm39) missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20,591,578 (GRCm39) missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20,584,909 (GRCm39) missense probably benign 0.01
R7196:Dsg4 UTSW 18 20,599,537 (GRCm39) missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20,579,323 (GRCm39) nonsense probably null
R7490:Dsg4 UTSW 18 20,584,993 (GRCm39) splice site probably null
R7612:Dsg4 UTSW 18 20,604,047 (GRCm39) missense probably damaging 1.00
R7639:Dsg4 UTSW 18 20,582,769 (GRCm39) missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20,587,726 (GRCm39) missense probably damaging 1.00
R8251:Dsg4 UTSW 18 20,604,221 (GRCm39) missense probably damaging 1.00
R8326:Dsg4 UTSW 18 20,582,788 (GRCm39) missense probably benign 0.31
R8554:Dsg4 UTSW 18 20,586,100 (GRCm39) missense probably damaging 1.00
R8911:Dsg4 UTSW 18 20,584,929 (GRCm39) nonsense probably null
R9059:Dsg4 UTSW 18 20,604,182 (GRCm39) missense possibly damaging 0.62
R9508:Dsg4 UTSW 18 20,604,070 (GRCm39) missense probably damaging 1.00
R9607:Dsg4 UTSW 18 20,586,047 (GRCm39) missense probably benign 0.00
R9765:Dsg4 UTSW 18 20,604,334 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGAAACACCCTGTCTTTCCAG -3'
(R):5'- TAGTAGTGAAATGTGAAACACTGC -3'

Sequencing Primer
(F):5'- GAAATCTACACCAATACTTACGCTGG -3'
(R):5'- TGTGAAACACTGCTATATATTGGC -3'
Posted On 2019-10-07