Mutagenetix > Incidental Mutation

Incidental Mutation 'R7439:Eif5b'

576791

Institutional Source

Beutler Lab

Gene Symbol

Eif5b

Ensembl Gene

ENSMUSG00000026083

Gene Name

eukaryotic translation initiation factor 5B

Synonyms

A030003E17Rik, IF2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7439 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

37998010-38055579 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 38051637 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 1192 (D1192A)

Ref Sequence

ENSEMBL: ENSMUSP00000027252 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027251] [ENSMUST00000027252]

AlphaFold

Q05D44

Predicted Effect

probably benign
Transcript: ENSMUST00000027251

SMART Domains

Protein: ENSMUSP00000027251
Gene: ENSMUSG00000026082

Domain	Start	End	E-Value	Type
BRCT	46	121	3.99e-13	SMART
low complexity region	320	342	N/A	INTRINSIC
Pfam:IMS	420	620	1.9e-43	PFAM
Pfam:IMS_C	700	831	5.8e-20	PFAM
low complexity region	888	901	N/A	INTRINSIC
Pfam:DUF4414	938	1071	9.7e-11	PFAM
Pfam:REV1_C	1127	1248	1.2e-43	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000027252
AA Change: D1192A

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000027252
Gene: ENSMUSG00000026083
AA Change: D1192A

Domain	Start	End	E-Value	Type
low complexity region	19	32	N/A	INTRINSIC
low complexity region	33	51	N/A	INTRINSIC
low complexity region	94	106	N/A	INTRINSIC
low complexity region	110	126	N/A	INTRINSIC
low complexity region	145	161	N/A	INTRINSIC
low complexity region	183	193	N/A	INTRINSIC
coiled coil region	227	272	N/A	INTRINSIC
coiled coil region	301	414	N/A	INTRINSIC
low complexity region	480	498	N/A	INTRINSIC
coiled coil region	523	554	N/A	INTRINSIC
low complexity region	580	594	N/A	INTRINSIC
Pfam:GTP_EFTU	625	840	4.7e-35	PFAM
Pfam:MMR_HSR1	629	753	5.1e-6	PFAM
Pfam:GTP_EFTU_D2	866	944	7.1e-11	PFAM
Pfam:IF-2	959	1066	1.4e-20	PFAM
Blast:S1	1116	1172	2e-6	BLAST

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accurate initiation of translation in eukaryotes is complex and requires many factors, some of which are composed of multiple subunits. The process is simpler in prokaryotes which have only three initiation factors (IF1, IF2, IF3). Two of these factors are conserved in eukaryotes: the homolog of IF1 is eIF1A and the homolog of IF2 is eIF5B. This gene encodes eIF5B. Factors eIF1A and eIF5B interact on the ribosome along with other initiation factors and GTP to position the initiation methionine tRNA on the start codon of the mRNA so that translation initiates accurately. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530003J23Rik	G	A	10: 117,238,697		probably benign	Het
Acacb	T	C	5: 114,195,642	V542A	possibly damaging	Het
Adprhl1	C	T	8: 13,223,069	V1230I	probably benign	Het
Agpat1	T	A	17: 34,610,909	Y77N	probably damaging	Het
Apc	T	A	18: 34,312,073	I674K	probably damaging	Het
Arpc5	T	C	1: 152,771,436	S97P	probably damaging	Het
Arrdc5	A	G	17: 56,297,931	F119L	probably benign	Het
Asap1	A	G	15: 64,130,256	V402A	probably damaging	Het
Aspg	T	C	12: 112,124,821	V479A	possibly damaging	Het
B3galnt2	G	A	13: 13,994,485	V368M	probably benign	Het
Bcl3	T	C	7: 19,822,611	T23A	probably benign	Het
Bpifb5	A	G	2: 154,228,933	K215E	possibly damaging	Het
Coa4	T	A	7: 100,539,271	C64S	probably damaging	Het
Dcun1d4	T	C	5: 73,491,536		probably null	Het
Dnaaf5	T	G	5: 139,166,113	C506W	probably damaging	Het
Dock3	A	G	9: 107,023,732	Y345H	probably damaging	Het
Dscaml1	A	G	9: 45,710,326	N1024S	possibly damaging	Het
Dsp	T	C	13: 38,176,502		probably null	Het
Dsp	A	G	13: 38,195,449	T2057A	probably benign	Het
Dync1h1	T	G	12: 110,636,453	L2176R	probably damaging	Het
Epn2	A	T	11: 61,546,848		probably benign	Het
Exoc1	T	A	5: 76,545,348	N360K	probably benign	Het
Fam135b	A	T	15: 71,463,680	V555E	probably damaging	Het
Fam208a	T	A	14: 27,471,645	V934E	probably damaging	Het
Fmn1	A	T	2: 113,441,611	Q108L	unknown	Het
Gcc2	A	G	10: 58,256,901	T48A	probably benign	Het
Gm438	T	C	4: 144,777,762	D273G	probably damaging	Het
Gm6619	T	G	6: 131,490,391	I73S	possibly damaging	Het
Gm8267	T	A	14: 44,722,940	D116V	probably damaging	Het
Hapln3	T	A	7: 79,117,269	T341S	probably benign	Het
Lamb3	C	A	1: 193,332,166	D544E	possibly damaging	Het
Lhx5	T	A	5: 120,440,284	S390T	probably benign	Het
Lrrc63	A	G	14: 75,126,257	S145P	possibly damaging	Het
Lrriq1	T	C	10: 103,214,519	M791V	probably benign	Het
Lyg2	A	G	1: 37,911,137	Y37H	possibly damaging	Het
Nrbp1	T	A	5: 31,244,956	M172K	probably damaging	Het
Olfr1044	T	A	2: 86,171,010	D269V	probably damaging	Het
Olfr1261	A	G	2: 89,993,839	I149V	probably benign	Het
Olfr168	T	G	16: 19,530,900	S7R	probably benign	Het
Pcyt2	A	T	11: 120,611,383	Y308N	possibly damaging	Het
Peg10	C	CTCA	6: 4,756,453		probably benign	Het
Phf21b	A	G	15: 84,804,903	S141P	probably damaging	Het
Pigh	G	A	12: 79,089,550	P24S	probably benign	Het
Plekhg3	A	G	12: 76,576,485	D834G	probably damaging	Het
Plekhg5	T	A	4: 152,113,935	V860D	probably benign	Het
Pon1	A	G	6: 5,177,399	I170T	probably damaging	Het
Ptpn9	T	A	9: 57,027,433	Y160*	probably null	Het
Ptprj	T	C	2: 90,449,819	K1045R	possibly damaging	Het
Rilpl2	T	A	5: 124,463,788	H196L	probably benign	Het
Rnf112	C	T	11: 61,451,028	V317I	possibly damaging	Het
Rundc3a	G	T	11: 102,400,046		probably null	Het
Sgsm1	T	C	5: 113,274,321	Y489C	probably damaging	Het
Sis	G	A	3: 72,909,041	H1531Y	possibly damaging	Het
Slc26a9	A	G	1: 131,762,818	Y520C	probably damaging	Het
Smc5	A	G	19: 23,242,700	V467A	probably damaging	Het
Spata20	G	A	11: 94,484,041	A245V	probably benign	Het
Steap3	A	C	1: 120,241,518	F350V	probably benign	Het
Sucnr1	A	G	3: 60,086,696	Q215R	probably benign	Het
Supv3l1	G	A	10: 62,430,615	A594V	probably damaging	Het
Swt1	A	T	1: 151,411,064	F226I	probably benign	Het
Taar7f	A	G	10: 24,049,987	T160A	possibly damaging	Het
Tada2a	A	T	11: 84,126,986		probably null	Het
Taok3	C	A	5: 117,250,909	Q460K	probably damaging	Het
Twf2	A	G	9: 106,214,398	E268G	probably damaging	Het
Upf2	A	T	2: 6,018,932	I698F	unknown	Het
Vmn2r35	T	A	7: 7,817,014	N86Y	probably damaging	Het
Vmn2r84	T	C	10: 130,392,113	T85A	possibly damaging	Het
Vps13d	A	G	4: 145,105,856	S2833P		Het
Xrn1	T	C	9: 96,051,629	S1584P	probably benign	Het
Zfp354b	T	C	11: 50,922,397	Y567C	probably damaging	Het
Zfp52	A	T	17: 21,560,870	R327*	probably null	Het

Other mutations in Eif5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Eif5b	APN	1	38041719	missense	probably damaging	1.00
IGL01377:Eif5b	APN	1	38036098	missense	probably benign
IGL01395:Eif5b	APN	1	38037258	missense	probably damaging	0.96
IGL01572:Eif5b	APN	1	38022254	nonsense	probably null
IGL01615:Eif5b	APN	1	38045706	missense	probably damaging	1.00
IGL02141:Eif5b	APN	1	38032322	missense	probably benign	0.09
IGL02260:Eif5b	APN	1	38045456	missense	possibly damaging	0.81
IGL02308:Eif5b	APN	1	38041747	missense	probably damaging	1.00
IGL03180:Eif5b	APN	1	38036269	missense	probably damaging	1.00
IGL03327:Eif5b	APN	1	38041691	splice site	probably benign
R0018:Eif5b	UTSW	1	38018889	missense	unknown
R0036:Eif5b	UTSW	1	38019111	missense	probably benign	0.23
R0137:Eif5b	UTSW	1	38019243	missense	probably benign	0.23
R0349:Eif5b	UTSW	1	38032366	missense	probably benign	0.18
R0606:Eif5b	UTSW	1	38048893	missense	probably damaging	1.00
R1056:Eif5b	UTSW	1	38022167	missense	unknown
R1225:Eif5b	UTSW	1	38037628	missense	probably damaging	1.00
R2043:Eif5b	UTSW	1	38041819	missense	probably damaging	1.00
R2163:Eif5b	UTSW	1	38048794	missense	probably benign	0.32
R2225:Eif5b	UTSW	1	38019223	missense	unknown
R2432:Eif5b	UTSW	1	38019342	missense	unknown
R2922:Eif5b	UTSW	1	38018019	splice site	probably benign
R4357:Eif5b	UTSW	1	38050258	missense	probably damaging	1.00
R4631:Eif5b	UTSW	1	38041747	missense	probably damaging	1.00
R4665:Eif5b	UTSW	1	38045712	missense	probably damaging	1.00
R4702:Eif5b	UTSW	1	38018877	missense	unknown
R4941:Eif5b	UTSW	1	38051199	missense	probably damaging	1.00
R4995:Eif5b	UTSW	1	38051711	makesense	probably null
R5020:Eif5b	UTSW	1	38019069	nonsense	probably null
R5175:Eif5b	UTSW	1	38045387	missense	probably damaging	1.00
R5375:Eif5b	UTSW	1	38045754	missense	possibly damaging	0.66
R5566:Eif5b	UTSW	1	38045684	missense	possibly damaging	0.90
R5566:Eif5b	UTSW	1	38051247	missense	probably damaging	1.00
R5853:Eif5b	UTSW	1	38037307	missense	probably damaging	1.00
R5978:Eif5b	UTSW	1	37998280	splice site	probably null
R6315:Eif5b	UTSW	1	38018033	missense	unknown
R6376:Eif5b	UTSW	1	38045679	missense	probably damaging	0.98
R6388:Eif5b	UTSW	1	38019000	missense	unknown
R6444:Eif5b	UTSW	1	38036211	missense	probably damaging	1.00
R6455:Eif5b	UTSW	1	38019027	missense	probably benign	0.23
R6810:Eif5b	UTSW	1	38046660	missense	probably benign	0.45
R6877:Eif5b	UTSW	1	38050239	missense	probably damaging	1.00
R7130:Eif5b	UTSW	1	38041776	missense	probably damaging	1.00
R7180:Eif5b	UTSW	1	38049074	missense	probably damaging	0.98
R7488:Eif5b	UTSW	1	38050306	missense	possibly damaging	0.69
R8140:Eif5b	UTSW	1	38051276	missense	probably benign	0.41
R8166:Eif5b	UTSW	1	38048820	missense	probably benign	0.11
R8191:Eif5b	UTSW	1	38036202	missense	probably damaging	0.98
R8304:Eif5b	UTSW	1	38045693	missense	probably benign	0.11
R8549:Eif5b	UTSW	1	38037207	missense	possibly damaging	0.96
R8558:Eif5b	UTSW	1	38044714	missense	probably damaging	0.99
R8893:Eif5b	UTSW	1	38051219	missense	possibly damaging	0.48
R9452:Eif5b	UTSW	1	38045780	missense	probably damaging	1.00
R9487:Eif5b	UTSW	1	38019370	nonsense	probably null
R9487:Eif5b	UTSW	1	38045479	missense	probably damaging	0.99
R9542:Eif5b	UTSW	1	38018050	nonsense	probably null
R9721:Eif5b	UTSW	1	38037659	critical splice donor site	probably null
R9745:Eif5b	UTSW	1	38045648	missense	probably damaging	1.00
R9748:Eif5b	UTSW	1	38051160	missense	possibly damaging	0.89
RF018:Eif5b	UTSW	1	38021592	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACAATCTCAGGGACTCCAGAG -3'
(R):5'- AACCAGTGTAAGTTGCTTGGTTTC -3'

Sequencing Primer
(F):5'- GACTCCAGAGCCACAGATGTG -3'
(R):5'- CAGTGTAAGTTGCTTGGTTTCTCATG -3'

Posted On

2019-10-07