Incidental Mutation 'R7439:Slc26a9'
ID576793
Institutional Source Beutler Lab
Gene Symbol Slc26a9
Ensembl Gene ENSMUSG00000042268
Gene Namesolute carrier family 26, member 9
Synonymsanion transporter/exchanger-9, E030002L01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.810) question?
Stock #R7439 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location131744022-131771504 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131762818 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 520 (Y520C)
Ref Sequence ENSEMBL: ENSMUSP00000036916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049027] [ENSMUST00000186122]
Predicted Effect probably damaging
Transcript: ENSMUST00000049027
AA Change: Y520C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036916
Gene: ENSMUSG00000042268
AA Change: Y520C

DomainStartEndE-ValueType
Pfam:Sulfate_transp 71 469 7.4e-99 PFAM
transmembrane domain 473 495 N/A INTRINSIC
Pfam:STAS 520 733 2.8e-27 PFAM
Predicted Effect silent
Transcript: ENSMUST00000186122
SMART Domains Protein: ENSMUSP00000141171
Gene: ENSMUSG00000042268

DomainStartEndE-ValueType
Pfam:Sulfate_transp 150 428 9.6e-58 PFAM
low complexity region 453 462 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one member of a family of sulfate/anion transporter genes. Family members are well conserved in their genomic (number and size of exons) and protein (aa length among species) structures yet have markedly different tissue expression patterns. The product of this gene is a highly selective chloride ion channel regulated by WNK kinases. Alternative splicing results in multiple transcript variants encoding differing isoforms.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced gastric secretory membranes and loss of gastric acid secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530003J23Rik G A 10: 117,238,697 probably benign Het
Acacb T C 5: 114,195,642 V542A possibly damaging Het
Adprhl1 C T 8: 13,223,069 V1230I probably benign Het
Agpat1 T A 17: 34,610,909 Y77N probably damaging Het
Apc T A 18: 34,312,073 I674K probably damaging Het
Arpc5 T C 1: 152,771,436 S97P probably damaging Het
Arrdc5 A G 17: 56,297,931 F119L probably benign Het
Asap1 A G 15: 64,130,256 V402A probably damaging Het
Aspg T C 12: 112,124,821 V479A possibly damaging Het
B3galnt2 G A 13: 13,994,485 V368M probably benign Het
Bcl3 T C 7: 19,822,611 T23A probably benign Het
Bpifb5 A G 2: 154,228,933 K215E possibly damaging Het
Coa4 T A 7: 100,539,271 C64S probably damaging Het
Dcun1d4 T C 5: 73,491,536 probably null Het
Dnaaf5 T G 5: 139,166,113 C506W probably damaging Het
Dock3 A G 9: 107,023,732 Y345H probably damaging Het
Dscaml1 A G 9: 45,710,326 N1024S possibly damaging Het
Dsp T C 13: 38,176,502 probably null Het
Dsp A G 13: 38,195,449 T2057A probably benign Het
Dync1h1 T G 12: 110,636,453 L2176R probably damaging Het
Eif5b A C 1: 38,051,637 D1192A probably benign Het
Epn2 A T 11: 61,546,848 probably benign Het
Exoc1 T A 5: 76,545,348 N360K probably benign Het
Fam135b A T 15: 71,463,680 V555E probably damaging Het
Fam208a T A 14: 27,471,645 V934E probably damaging Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Gcc2 A G 10: 58,256,901 T48A probably benign Het
Gm438 T C 4: 144,777,762 D273G probably damaging Het
Gm6619 T G 6: 131,490,391 I73S possibly damaging Het
Gm8267 T A 14: 44,722,940 D116V probably damaging Het
Hapln3 T A 7: 79,117,269 T341S probably benign Het
Lamb3 C A 1: 193,332,166 D544E possibly damaging Het
Lhx5 T A 5: 120,440,284 S390T probably benign Het
Lrrc63 A G 14: 75,126,257 S145P possibly damaging Het
Lrriq1 T C 10: 103,214,519 M791V probably benign Het
Lyg2 A G 1: 37,911,137 Y37H possibly damaging Het
Nrbp1 T A 5: 31,244,956 M172K probably damaging Het
Olfr1044 T A 2: 86,171,010 D269V probably damaging Het
Olfr1261 A G 2: 89,993,839 I149V probably benign Het
Olfr168 T G 16: 19,530,900 S7R probably benign Het
Pcyt2 A T 11: 120,611,383 Y308N possibly damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Phf21b A G 15: 84,804,903 S141P probably damaging Het
Pigh G A 12: 79,089,550 P24S probably benign Het
Plekhg3 A G 12: 76,576,485 D834G probably damaging Het
Plekhg5 T A 4: 152,113,935 V860D probably benign Het
Pon1 A G 6: 5,177,399 I170T probably damaging Het
Ptpn9 T A 9: 57,027,433 Y160* probably null Het
Ptprj T C 2: 90,449,819 K1045R possibly damaging Het
Rilpl2 T A 5: 124,463,788 H196L probably benign Het
Rnf112 C T 11: 61,451,028 V317I possibly damaging Het
Rundc3a G T 11: 102,400,046 probably null Het
Sgsm1 T C 5: 113,274,321 Y489C probably damaging Het
Sis G A 3: 72,909,041 H1531Y possibly damaging Het
Smc5 A G 19: 23,242,700 V467A probably damaging Het
Spata20 G A 11: 94,484,041 A245V probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Sucnr1 A G 3: 60,086,696 Q215R probably benign Het
Supv3l1 G A 10: 62,430,615 A594V probably damaging Het
Swt1 A T 1: 151,411,064 F226I probably benign Het
Taar7f A G 10: 24,049,987 T160A possibly damaging Het
Tada2a A T 11: 84,126,986 probably null Het
Taok3 C A 5: 117,250,909 Q460K probably damaging Het
Twf2 A G 9: 106,214,398 E268G probably damaging Het
Upf2 A T 2: 6,018,932 I698F unknown Het
Vmn2r35 T A 7: 7,817,014 N86Y probably damaging Het
Vmn2r84 T C 10: 130,392,113 T85A possibly damaging Het
Vps13d A G 4: 145,105,856 S2833P Het
Xrn1 T C 9: 96,051,629 S1584P probably benign Het
Zfp354b T C 11: 50,922,397 Y567C probably damaging Het
Zfp52 A T 17: 21,560,870 R327* probably null Het
Other mutations in Slc26a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Slc26a9 APN 1 131757528 missense probably damaging 0.97
IGL01131:Slc26a9 APN 1 131755542 splice site probably null
IGL01544:Slc26a9 APN 1 131759495 critical splice donor site probably null
IGL01845:Slc26a9 APN 1 131757518 missense probably damaging 0.99
IGL02125:Slc26a9 APN 1 131759437 missense probably damaging 1.00
IGL02151:Slc26a9 APN 1 131764043 missense probably damaging 1.00
IGL02267:Slc26a9 APN 1 131752845 missense probably damaging 1.00
IGL02469:Slc26a9 APN 1 131762936 missense probably damaging 0.96
IGL03137:Slc26a9 APN 1 131763877 missense probably benign 0.01
IGL03324:Slc26a9 APN 1 131764010 missense probably damaging 1.00
R0588:Slc26a9 UTSW 1 131754011 splice site probably benign
R0611:Slc26a9 UTSW 1 131762761 missense probably damaging 1.00
R0639:Slc26a9 UTSW 1 131763804 missense probably damaging 0.97
R0654:Slc26a9 UTSW 1 131765030 missense probably benign 0.00
R0926:Slc26a9 UTSW 1 131753216 missense probably benign 0.40
R1109:Slc26a9 UTSW 1 131758798 missense probably benign 0.05
R1521:Slc26a9 UTSW 1 131750677 missense probably damaging 1.00
R1728:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1728:Slc26a9 UTSW 1 131766012 missense probably benign
R1729:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1729:Slc26a9 UTSW 1 131766012 missense probably benign
R1730:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1739:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1762:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1762:Slc26a9 UTSW 1 131766012 missense probably benign
R1783:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1783:Slc26a9 UTSW 1 131766012 missense probably benign
R1784:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1784:Slc26a9 UTSW 1 131766012 missense probably benign
R1785:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1785:Slc26a9 UTSW 1 131766012 missense probably benign
R1992:Slc26a9 UTSW 1 131762794 missense probably damaging 1.00
R2198:Slc26a9 UTSW 1 131763263 splice site probably benign
R3008:Slc26a9 UTSW 1 131765914 missense probably damaging 1.00
R3409:Slc26a9 UTSW 1 131763944 missense probably benign
R3879:Slc26a9 UTSW 1 131769231 missense probably benign 0.39
R4064:Slc26a9 UTSW 1 131763187 missense probably benign 0.01
R4088:Slc26a9 UTSW 1 131767849 missense possibly damaging 0.49
R4657:Slc26a9 UTSW 1 131753138 missense probably damaging 1.00
R5005:Slc26a9 UTSW 1 131765887 missense probably damaging 0.99
R6255:Slc26a9 UTSW 1 131763909 missense probably benign 0.00
R6418:Slc26a9 UTSW 1 131758490 missense probably benign 0.06
R6442:Slc26a9 UTSW 1 131758817 missense possibly damaging 0.58
R6674:Slc26a9 UTSW 1 131765018 missense probably benign 0.01
R6719:Slc26a9 UTSW 1 131761785 missense probably benign 0.13
R7202:Slc26a9 UTSW 1 131762788 missense possibly damaging 0.77
R7214:Slc26a9 UTSW 1 131759473 missense probably damaging 0.99
R7238:Slc26a9 UTSW 1 131758818 nonsense probably null
R7389:Slc26a9 UTSW 1 131769248 makesense probably null
R7441:Slc26a9 UTSW 1 131762818 missense probably damaging 1.00
R7470:Slc26a9 UTSW 1 131764043 missense probably benign 0.33
R7515:Slc26a9 UTSW 1 131753973 missense probably damaging 0.99
R7652:Slc26a9 UTSW 1 131763896 missense probably benign 0.06
R7655:Slc26a9 UTSW 1 131763244 missense possibly damaging 0.88
R7656:Slc26a9 UTSW 1 131763244 missense possibly damaging 0.88
R8278:Slc26a9 UTSW 1 131761776 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CCTACATAAGAGCAGGAGTCCC -3'
(R):5'- TGCCTGAAGATCTCTGAGTTGG -3'

Sequencing Primer
(F):5'- GGCTCGCAACCATCTGTAATGAG -3'
(R):5'- CCTGAAGATCTCTGAGTTGGCAAAG -3'
Posted On2019-10-07