Incidental Mutation 'R7439:Swt1'
ID576794
Institutional Source Beutler Lab
Gene Symbol Swt1
Ensembl Gene ENSMUSG00000052748
Gene NameSWT1 RNA endoribonuclease homolog (S. cerevisiae)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R7439 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location151367699-151428455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 151411064 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 226 (F226I)
Ref Sequence ENSEMBL: ENSMUSP00000067516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064771] [ENSMUST00000111883]
Predicted Effect probably benign
Transcript: ENSMUST00000064771
AA Change: F226I

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000067516
Gene: ENSMUSG00000052748
AA Change: F226I

DomainStartEndE-ValueType
low complexity region 186 206 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
PINc 395 522 1.94e-9 SMART
low complexity region 783 793 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111883
AA Change: F226I

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107514
Gene: ENSMUSG00000052748
AA Change: F226I

DomainStartEndE-ValueType
low complexity region 186 206 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
PINc 395 522 1.94e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129939
SMART Domains Protein: ENSMUSP00000120483
Gene: ENSMUSG00000052748

DomainStartEndE-ValueType
PINc 146 245 6.78e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530003J23Rik G A 10: 117,238,697 probably benign Het
Acacb T C 5: 114,195,642 V542A possibly damaging Het
Adprhl1 C T 8: 13,223,069 V1230I probably benign Het
Agpat1 T A 17: 34,610,909 Y77N probably damaging Het
Apc T A 18: 34,312,073 I674K probably damaging Het
Arpc5 T C 1: 152,771,436 S97P probably damaging Het
Arrdc5 A G 17: 56,297,931 F119L probably benign Het
Asap1 A G 15: 64,130,256 V402A probably damaging Het
Aspg T C 12: 112,124,821 V479A possibly damaging Het
B3galnt2 G A 13: 13,994,485 V368M probably benign Het
Bcl3 T C 7: 19,822,611 T23A probably benign Het
Bpifb5 A G 2: 154,228,933 K215E possibly damaging Het
Coa4 T A 7: 100,539,271 C64S probably damaging Het
Dcun1d4 T C 5: 73,491,536 probably null Het
Dnaaf5 T G 5: 139,166,113 C506W probably damaging Het
Dock3 A G 9: 107,023,732 Y345H probably damaging Het
Dscaml1 A G 9: 45,710,326 N1024S possibly damaging Het
Dsp T C 13: 38,176,502 probably null Het
Dsp A G 13: 38,195,449 T2057A probably benign Het
Dync1h1 T G 12: 110,636,453 L2176R probably damaging Het
Eif5b A C 1: 38,051,637 D1192A probably benign Het
Epn2 A T 11: 61,546,848 probably benign Het
Exoc1 T A 5: 76,545,348 N360K probably benign Het
Fam135b A T 15: 71,463,680 V555E probably damaging Het
Fam208a T A 14: 27,471,645 V934E probably damaging Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Gcc2 A G 10: 58,256,901 T48A probably benign Het
Gm438 T C 4: 144,777,762 D273G probably damaging Het
Gm6619 T G 6: 131,490,391 I73S possibly damaging Het
Gm8267 T A 14: 44,722,940 D116V probably damaging Het
Hapln3 T A 7: 79,117,269 T341S probably benign Het
Lamb3 C A 1: 193,332,166 D544E possibly damaging Het
Lhx5 T A 5: 120,440,284 S390T probably benign Het
Lrrc63 A G 14: 75,126,257 S145P possibly damaging Het
Lrriq1 T C 10: 103,214,519 M791V probably benign Het
Lyg2 A G 1: 37,911,137 Y37H possibly damaging Het
Nrbp1 T A 5: 31,244,956 M172K probably damaging Het
Olfr1044 T A 2: 86,171,010 D269V probably damaging Het
Olfr1261 A G 2: 89,993,839 I149V probably benign Het
Olfr168 T G 16: 19,530,900 S7R probably benign Het
Pcyt2 A T 11: 120,611,383 Y308N possibly damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Phf21b A G 15: 84,804,903 S141P probably damaging Het
Pigh G A 12: 79,089,550 P24S probably benign Het
Plekhg3 A G 12: 76,576,485 D834G probably damaging Het
Plekhg5 T A 4: 152,113,935 V860D probably benign Het
Pon1 A G 6: 5,177,399 I170T probably damaging Het
Ptpn9 T A 9: 57,027,433 Y160* probably null Het
Ptprj T C 2: 90,449,819 K1045R possibly damaging Het
Rilpl2 T A 5: 124,463,788 H196L probably benign Het
Rnf112 C T 11: 61,451,028 V317I possibly damaging Het
Rundc3a G T 11: 102,400,046 probably null Het
Sgsm1 T C 5: 113,274,321 Y489C probably damaging Het
Sis G A 3: 72,909,041 H1531Y possibly damaging Het
Slc26a9 A G 1: 131,762,818 Y520C probably damaging Het
Smc5 A G 19: 23,242,700 V467A probably damaging Het
Spata20 G A 11: 94,484,041 A245V probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Sucnr1 A G 3: 60,086,696 Q215R probably benign Het
Supv3l1 G A 10: 62,430,615 A594V probably damaging Het
Taar7f A G 10: 24,049,987 T160A possibly damaging Het
Tada2a A T 11: 84,126,986 probably null Het
Taok3 C A 5: 117,250,909 Q460K probably damaging Het
Twf2 A G 9: 106,214,398 E268G probably damaging Het
Upf2 A T 2: 6,018,932 I698F unknown Het
Vmn2r35 T A 7: 7,817,014 N86Y probably damaging Het
Vmn2r84 T C 10: 130,392,113 T85A possibly damaging Het
Vps13d A G 4: 145,105,856 S2833P Het
Xrn1 T C 9: 96,051,629 S1584P probably benign Het
Zfp354b T C 11: 50,922,397 Y567C probably damaging Het
Zfp52 A T 17: 21,560,870 R327* probably null Het
Other mutations in Swt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Swt1 APN 1 151411139 missense probably damaging 0.99
IGL01622:Swt1 APN 1 151411009 missense probably benign 0.01
IGL01623:Swt1 APN 1 151411009 missense probably benign 0.01
IGL01672:Swt1 APN 1 151394608 critical splice donor site probably null
IGL01693:Swt1 APN 1 151422104 missense probably benign 0.02
IGL02203:Swt1 APN 1 151370626 missense probably benign 0.01
IGL03223:Swt1 APN 1 151379419 missense possibly damaging 0.80
R0124:Swt1 UTSW 1 151391529 missense probably damaging 1.00
R0496:Swt1 UTSW 1 151411270 missense probably benign
R1037:Swt1 UTSW 1 151370569 splice site probably benign
R1171:Swt1 UTSW 1 151405521 missense probably damaging 1.00
R1270:Swt1 UTSW 1 151384391 missense probably benign 0.00
R1883:Swt1 UTSW 1 151423533 nonsense probably null
R2051:Swt1 UTSW 1 151372330 missense probably damaging 1.00
R2110:Swt1 UTSW 1 151403885 missense probably damaging 0.97
R2185:Swt1 UTSW 1 151384468 missense probably damaging 1.00
R3688:Swt1 UTSW 1 151391489 missense probably damaging 0.99
R3785:Swt1 UTSW 1 151379404 missense probably benign 0.03
R4074:Swt1 UTSW 1 151394769 missense probably benign
R4157:Swt1 UTSW 1 151403044 missense probably damaging 1.00
R4660:Swt1 UTSW 1 151407597 missense probably benign 0.18
R4761:Swt1 UTSW 1 151401102 missense probably benign 0.43
R4972:Swt1 UTSW 1 151423542 missense probably benign 0.22
R5141:Swt1 UTSW 1 151411394 missense probably benign 0.04
R5227:Swt1 UTSW 1 151402976 nonsense probably null
R5400:Swt1 UTSW 1 151412834 missense probably benign 0.00
R5580:Swt1 UTSW 1 151384455 missense probably benign 0.00
R5912:Swt1 UTSW 1 151411409 missense probably damaging 1.00
R5945:Swt1 UTSW 1 151411170 missense probably benign 0.01
R5973:Swt1 UTSW 1 151402949 splice site probably null
R5979:Swt1 UTSW 1 151407588 missense possibly damaging 0.94
R6242:Swt1 UTSW 1 151407614 missense probably benign 0.41
R6283:Swt1 UTSW 1 151384333 missense possibly damaging 0.78
R6951:Swt1 UTSW 1 151397268 missense possibly damaging 0.88
R7009:Swt1 UTSW 1 151370630 missense possibly damaging 0.94
R7165:Swt1 UTSW 1 151388677 missense probably damaging 1.00
R7214:Swt1 UTSW 1 151394613 missense possibly damaging 0.63
R7403:Swt1 UTSW 1 151388693 missense probably benign 0.01
R7441:Swt1 UTSW 1 151411064 missense probably benign 0.04
R7571:Swt1 UTSW 1 151394719 missense probably benign 0.00
R8028:Swt1 UTSW 1 151384497 missense probably benign 0.26
R8225:Swt1 UTSW 1 151422108 missense possibly damaging 0.96
X0062:Swt1 UTSW 1 151411439 missense probably benign 0.43
Z1176:Swt1 UTSW 1 151388685 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTCTCACAAACAGACTGCTTATG -3'
(R):5'- TCTAAACCTGTAGACCAGACAAAGG -3'

Sequencing Primer
(F):5'- CTCACAAACAGACTGCTTATGTGTAG -3'
(R):5'- ACAAAGGAAAAGAATTGGCCTTC -3'
Posted On2019-10-07