Mutagenetix > Incidental Mutation

Incidental Mutation 'R7439:Upf2'

576797

Institutional Source

Beutler Lab

Gene Symbol

Upf2

Ensembl Gene

ENSMUSG00000043241

Gene Name

UPF2 regulator of nonsense transcripts homolog (yeast)

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7439 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

5951469-6056703 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 6018932 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 698 (I698F)

Ref Sequence

ENSEMBL: ENSMUSP00000058375 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060092]

AlphaFold

A2AT37

Predicted Effect

unknown
Transcript: ENSMUST00000060092
AA Change: I698F

SMART Domains

Protein: ENSMUSP00000058375
Gene: ENSMUSG00000043241
AA Change: I698F

Domain	Start	End	E-Value	Type
low complexity region	12	23	N/A	INTRINSIC
low complexity region	54	125	N/A	INTRINSIC
MIF4G	167	363	1.22e-32	SMART
coiled coil region	514	543	N/A	INTRINSIC
MIF4G	567	756	1.13e-50	SMART
MIF4G	771	984	3.43e-50	SMART
low complexity region	1023	1042	N/A	INTRINSIC
Pfam:Upf2	1051	1215	1.5e-45	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128200

SMART Domains

Protein: ENSMUSP00000119348
Gene: ENSMUSG00000043241

Domain	Start	End	E-Value	Type
MIF4G	27	240	3.43e-50	SMART
low complexity region	279	298	N/A	INTRINSIC
Pfam:Upf2	304	469	3.1e-44	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located in the perinuclear area. It interacts with translation release factors and the proteins that are functional homologs of yeast Upf1p and Upf3p. Two splice variants have been found for this gene; both variants encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530003J23Rik	G	A	10: 117,238,697		probably benign	Het
Acacb	T	C	5: 114,195,642	V542A	possibly damaging	Het
Adprhl1	C	T	8: 13,223,069	V1230I	probably benign	Het
Agpat1	T	A	17: 34,610,909	Y77N	probably damaging	Het
Apc	T	A	18: 34,312,073	I674K	probably damaging	Het
Arpc5	T	C	1: 152,771,436	S97P	probably damaging	Het
Arrdc5	A	G	17: 56,297,931	F119L	probably benign	Het
Asap1	A	G	15: 64,130,256	V402A	probably damaging	Het
Aspg	T	C	12: 112,124,821	V479A	possibly damaging	Het
B3galnt2	G	A	13: 13,994,485	V368M	probably benign	Het
Bcl3	T	C	7: 19,822,611	T23A	probably benign	Het
Bpifb5	A	G	2: 154,228,933	K215E	possibly damaging	Het
Coa4	T	A	7: 100,539,271	C64S	probably damaging	Het
Dcun1d4	T	C	5: 73,491,536		probably null	Het
Dnaaf5	T	G	5: 139,166,113	C506W	probably damaging	Het
Dock3	A	G	9: 107,023,732	Y345H	probably damaging	Het
Dscaml1	A	G	9: 45,710,326	N1024S	possibly damaging	Het
Dsp	T	C	13: 38,176,502		probably null	Het
Dsp	A	G	13: 38,195,449	T2057A	probably benign	Het
Dync1h1	T	G	12: 110,636,453	L2176R	probably damaging	Het
Eif5b	A	C	1: 38,051,637	D1192A	probably benign	Het
Epn2	A	T	11: 61,546,848		probably benign	Het
Exoc1	T	A	5: 76,545,348	N360K	probably benign	Het
Fam135b	A	T	15: 71,463,680	V555E	probably damaging	Het
Fam208a	T	A	14: 27,471,645	V934E	probably damaging	Het
Fmn1	A	T	2: 113,441,611	Q108L	unknown	Het
Gcc2	A	G	10: 58,256,901	T48A	probably benign	Het
Gm438	T	C	4: 144,777,762	D273G	probably damaging	Het
Gm6619	T	G	6: 131,490,391	I73S	possibly damaging	Het
Gm8267	T	A	14: 44,722,940	D116V	probably damaging	Het
Hapln3	T	A	7: 79,117,269	T341S	probably benign	Het
Lamb3	C	A	1: 193,332,166	D544E	possibly damaging	Het
Lhx5	T	A	5: 120,440,284	S390T	probably benign	Het
Lrrc63	A	G	14: 75,126,257	S145P	possibly damaging	Het
Lrriq1	T	C	10: 103,214,519	M791V	probably benign	Het
Lyg2	A	G	1: 37,911,137	Y37H	possibly damaging	Het
Nrbp1	T	A	5: 31,244,956	M172K	probably damaging	Het
Olfr1044	T	A	2: 86,171,010	D269V	probably damaging	Het
Olfr1261	A	G	2: 89,993,839	I149V	probably benign	Het
Olfr168	T	G	16: 19,530,900	S7R	probably benign	Het
Pcyt2	A	T	11: 120,611,383	Y308N	possibly damaging	Het
Peg10	C	CTCA	6: 4,756,453		probably benign	Het
Phf21b	A	G	15: 84,804,903	S141P	probably damaging	Het
Pigh	G	A	12: 79,089,550	P24S	probably benign	Het
Plekhg3	A	G	12: 76,576,485	D834G	probably damaging	Het
Plekhg5	T	A	4: 152,113,935	V860D	probably benign	Het
Pon1	A	G	6: 5,177,399	I170T	probably damaging	Het
Ptpn9	T	A	9: 57,027,433	Y160*	probably null	Het
Ptprj	T	C	2: 90,449,819	K1045R	possibly damaging	Het
Rilpl2	T	A	5: 124,463,788	H196L	probably benign	Het
Rnf112	C	T	11: 61,451,028	V317I	possibly damaging	Het
Rundc3a	G	T	11: 102,400,046		probably null	Het
Sgsm1	T	C	5: 113,274,321	Y489C	probably damaging	Het
Sis	G	A	3: 72,909,041	H1531Y	possibly damaging	Het
Slc26a9	A	G	1: 131,762,818	Y520C	probably damaging	Het
Smc5	A	G	19: 23,242,700	V467A	probably damaging	Het
Spata20	G	A	11: 94,484,041	A245V	probably benign	Het
Steap3	A	C	1: 120,241,518	F350V	probably benign	Het
Sucnr1	A	G	3: 60,086,696	Q215R	probably benign	Het
Supv3l1	G	A	10: 62,430,615	A594V	probably damaging	Het
Swt1	A	T	1: 151,411,064	F226I	probably benign	Het
Taar7f	A	G	10: 24,049,987	T160A	possibly damaging	Het
Tada2a	A	T	11: 84,126,986		probably null	Het
Taok3	C	A	5: 117,250,909	Q460K	probably damaging	Het
Twf2	A	G	9: 106,214,398	E268G	probably damaging	Het
Vmn2r35	T	A	7: 7,817,014	N86Y	probably damaging	Het
Vmn2r84	T	C	10: 130,392,113	T85A	possibly damaging	Het
Vps13d	A	G	4: 145,105,856	S2833P		Het
Xrn1	T	C	9: 96,051,629	S1584P	probably benign	Het
Zfp354b	T	C	11: 50,922,397	Y567C	probably damaging	Het
Zfp52	A	T	17: 21,560,870	R327*	probably null	Het

Other mutations in Upf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01065:Upf2	APN	2	5961300	missense	unknown
IGL01394:Upf2	APN	2	6040213	splice site	probably null
IGL01571:Upf2	APN	2	6018939	unclassified	probably benign
IGL01624:Upf2	APN	2	6034179	missense	probably benign
IGL02121:Upf2	APN	2	6026323	splice site	probably benign
IGL02485:Upf2	APN	2	6027291	missense	unknown
IGL02491:Upf2	APN	2	6026164	missense	unknown
balderdash	UTSW	2	5973536	missense	unknown
nonsense	UTSW	2	6047034	missense	unknown
R0265:Upf2	UTSW	2	6027204	splice site	probably benign
R0390:Upf2	UTSW	2	6018894	unclassified	probably benign
R0480:Upf2	UTSW	2	5957634	missense	possibly damaging	0.71
R0513:Upf2	UTSW	2	5957667	missense	unknown
R0579:Upf2	UTSW	2	5988429	missense	unknown
R0612:Upf2	UTSW	2	6034098	splice site	probably benign
R0856:Upf2	UTSW	2	5957652	missense	unknown
R1103:Upf2	UTSW	2	6026175	missense	unknown
R1384:Upf2	UTSW	2	5960989	missense	unknown
R1672:Upf2	UTSW	2	6040097	splice site	probably null
R1728:Upf2	UTSW	2	6027450	missense	probably damaging	1.00
R1784:Upf2	UTSW	2	6027450	missense	probably damaging	1.00
R1836:Upf2	UTSW	2	6050324	splice site	probably null
R2252:Upf2	UTSW	2	5961460	missense	unknown
R2339:Upf2	UTSW	2	6040102	splice site	probably benign
R3015:Upf2	UTSW	2	5976079	missense	unknown
R3931:Upf2	UTSW	2	6047010	missense	unknown
R4151:Upf2	UTSW	2	5961705	missense	unknown
R4283:Upf2	UTSW	2	5973558	missense	unknown
R4558:Upf2	UTSW	2	5973593	missense	unknown
R4564:Upf2	UTSW	2	6027312	missense	unknown
R5630:Upf2	UTSW	2	6027301	missense	probably damaging	0.99
R6370:Upf2	UTSW	2	5976010	missense	unknown
R6418:Upf2	UTSW	2	6027339	missense	unknown
R6432:Upf2	UTSW	2	5979777	missense	unknown
R7184:Upf2	UTSW	2	6023320	missense	unknown
R7308:Upf2	UTSW	2	5973518	missense	unknown
R7371:Upf2	UTSW	2	5961040	missense	unknown
R7404:Upf2	UTSW	2	6040203	missense	unknown
R7441:Upf2	UTSW	2	6018932	missense	unknown
R7461:Upf2	UTSW	2	5973536	missense	unknown
R7483:Upf2	UTSW	2	6027408	missense	unknown
R7613:Upf2	UTSW	2	5973536	missense	unknown
R7976:Upf2	UTSW	2	6026115	missense	unknown
R8044:Upf2	UTSW	2	6029438	missense	unknown
R8516:Upf2	UTSW	2	6018971	missense	unknown
R8880:Upf2	UTSW	2	6026172	missense	unknown
R8911:Upf2	UTSW	2	5983082	missense	unknown
R9138:Upf2	UTSW	2	6023321	missense	unknown
R9226:Upf2	UTSW	2	6047034	missense	unknown
R9444:Upf2	UTSW	2	6018944	missense	unknown
R9484:Upf2	UTSW	2	5961267	missense	unknown
R9665:Upf2	UTSW	2	6046904	missense	unknown
R9691:Upf2	UTSW	2	6027213	missense	unknown
Z1176:Upf2	UTSW	2	6023388	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ATTTGATGGAGAGCAAGGCATTTAG -3'
(R):5'- CCAGTATGGCGGTTCATTTG -3'

Sequencing Primer
(F):5'- GTTGTTATGCACAGATGCATA -3'
(R):5'- GCAGGATGTTCTAGATTAGGCAG -3'

Posted On

2019-10-07