Incidental Mutation 'R7439:Or4c126'
ID 576799
Institutional Source Beutler Lab
Gene Symbol Or4c126
Ensembl Gene ENSMUSG00000061295
Gene Name olfactory receptor family 4 subfamily C member 126
Synonyms MOR234-3, Olfr1261, GA_x6K02T2Q125-51425355-51426275
MMRRC Submission 045515-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.051) question?
Stock # R7439 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 89823739-89824659 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 89824183 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 149 (I149V)
Ref Sequence ENSEMBL: ENSMUSP00000150341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077785] [ENSMUST00000111509] [ENSMUST00000213909] [ENSMUST00000216953]
AlphaFold Q8VFB0
Predicted Effect probably benign
Transcript: ENSMUST00000077785
AA Change: I149V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000076959
Gene: ENSMUSG00000061295
AA Change: I149V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 30 297 1.5e-6 PFAM
Pfam:7tm_1 36 282 4.5e-26 PFAM
Pfam:7tm_4 134 275 4.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111509
SMART Domains Protein: ENSMUSP00000107134
Gene: ENSMUSG00000061295

DomainStartEndE-ValueType
Pfam:7tm_4 25 299 1.8e-41 PFAM
Pfam:7TM_GPCR_Srsx 30 297 1.5e-6 PFAM
Pfam:7tm_1 36 282 4.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213909
AA Change: I149V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000216953
AA Change: I149V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm5 T C 4: 144,504,332 (GRCm39) D273G probably damaging Het
Acacb T C 5: 114,333,703 (GRCm39) V542A possibly damaging Het
Adprhl1 C T 8: 13,273,069 (GRCm39) V1230I probably benign Het
Agpat1 T A 17: 34,829,883 (GRCm39) Y77N probably damaging Het
Apc T A 18: 34,445,126 (GRCm39) I674K probably damaging Het
Arpc5 T C 1: 152,647,187 (GRCm39) S97P probably damaging Het
Arrdc5 A G 17: 56,604,931 (GRCm39) F119L probably benign Het
Asap1 A G 15: 64,002,105 (GRCm39) V402A probably damaging Het
Aspg T C 12: 112,091,255 (GRCm39) V479A possibly damaging Het
B3galnt2 G A 13: 14,169,070 (GRCm39) V368M probably benign Het
Bcl3 T C 7: 19,556,536 (GRCm39) T23A probably benign Het
Bpifb5 A G 2: 154,070,853 (GRCm39) K215E possibly damaging Het
Coa4 T A 7: 100,188,478 (GRCm39) C64S probably damaging Het
Dcun1d4 T C 5: 73,648,879 (GRCm39) probably null Het
Dnaaf5 T G 5: 139,151,868 (GRCm39) C506W probably damaging Het
Dock3 A G 9: 106,900,931 (GRCm39) Y345H probably damaging Het
Dscaml1 A G 9: 45,621,624 (GRCm39) N1024S possibly damaging Het
Dsp T C 13: 38,360,478 (GRCm39) probably null Het
Dsp A G 13: 38,379,425 (GRCm39) T2057A probably benign Het
Dync1h1 T G 12: 110,602,887 (GRCm39) L2176R probably damaging Het
Eif5b A C 1: 38,090,718 (GRCm39) D1192A probably benign Het
Epn2 A T 11: 61,437,674 (GRCm39) probably benign Het
Exoc1 T A 5: 76,693,195 (GRCm39) N360K probably benign Het
Fam135b A T 15: 71,335,529 (GRCm39) V555E probably damaging Het
Fmn1 A T 2: 113,271,956 (GRCm39) Q108L unknown Het
Gcc2 A G 10: 58,092,723 (GRCm39) T48A probably benign Het
Gm6619 T G 6: 131,467,354 (GRCm39) I73S possibly damaging Het
Gm8267 T A 14: 44,960,397 (GRCm39) D116V probably damaging Het
Hapln3 T A 7: 78,767,017 (GRCm39) T341S probably benign Het
Lamb3 C A 1: 193,014,474 (GRCm39) D544E possibly damaging Het
Lhx5 T A 5: 120,578,349 (GRCm39) S390T probably benign Het
Lrrc63 A G 14: 75,363,697 (GRCm39) S145P possibly damaging Het
Lrriq1 T C 10: 103,050,380 (GRCm39) M791V probably benign Het
Lyg2 A G 1: 37,950,218 (GRCm39) Y37H possibly damaging Het
Lyz3 G A 10: 117,074,602 (GRCm39) probably benign Het
Nrbp1 T A 5: 31,402,300 (GRCm39) M172K probably damaging Het
Or2l13b T G 16: 19,349,650 (GRCm39) S7R probably benign Het
Or8u9 T A 2: 86,001,354 (GRCm39) D269V probably damaging Het
Pcyt2 A T 11: 120,502,209 (GRCm39) Y308N possibly damaging Het
Peg10 C CTCA 6: 4,756,453 (GRCm39) probably benign Het
Phf21b A G 15: 84,689,104 (GRCm39) S141P probably damaging Het
Pigh G A 12: 79,136,324 (GRCm39) P24S probably benign Het
Plekhg3 A G 12: 76,623,259 (GRCm39) D834G probably damaging Het
Plekhg5 T A 4: 152,198,392 (GRCm39) V860D probably benign Het
Pon1 A G 6: 5,177,399 (GRCm39) I170T probably damaging Het
Ptpn9 T A 9: 56,934,717 (GRCm39) Y160* probably null Het
Ptprj T C 2: 90,280,163 (GRCm39) K1045R possibly damaging Het
Rilpl2 T A 5: 124,601,851 (GRCm39) H196L probably benign Het
Rnf112 C T 11: 61,341,854 (GRCm39) V317I possibly damaging Het
Rundc3a G T 11: 102,290,872 (GRCm39) probably null Het
Sgsm1 T C 5: 113,422,187 (GRCm39) Y489C probably damaging Het
Sis G A 3: 72,816,374 (GRCm39) H1531Y possibly damaging Het
Slc26a9 A G 1: 131,690,556 (GRCm39) Y520C probably damaging Het
Smc5 A G 19: 23,220,064 (GRCm39) V467A probably damaging Het
Spata20 G A 11: 94,374,867 (GRCm39) A245V probably benign Het
Steap3 A C 1: 120,169,248 (GRCm39) F350V probably benign Het
Sucnr1 A G 3: 59,994,117 (GRCm39) Q215R probably benign Het
Supv3l1 G A 10: 62,266,394 (GRCm39) A594V probably damaging Het
Swt1 A T 1: 151,286,815 (GRCm39) F226I probably benign Het
Taar7f A G 10: 23,925,885 (GRCm39) T160A possibly damaging Het
Tada2a A T 11: 84,017,812 (GRCm39) probably null Het
Taok3 C A 5: 117,388,974 (GRCm39) Q460K probably damaging Het
Tasor T A 14: 27,193,602 (GRCm39) V934E probably damaging Het
Twf2 A G 9: 106,091,597 (GRCm39) E268G probably damaging Het
Upf2 A T 2: 6,023,743 (GRCm39) I698F unknown Het
Vmn2r35 T A 7: 7,820,013 (GRCm39) N86Y probably damaging Het
Vmn2r84 T C 10: 130,227,982 (GRCm39) T85A possibly damaging Het
Vps13d A G 4: 144,832,426 (GRCm39) S2833P Het
Xrn1 T C 9: 95,933,682 (GRCm39) S1584P probably benign Het
Zfp354b T C 11: 50,813,224 (GRCm39) Y567C probably damaging Het
Zfp52 A T 17: 21,781,132 (GRCm39) R327* probably null Het
Other mutations in Or4c126
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02582:Or4c126 APN 2 89,824,656 (GRCm39) missense probably benign 0.00
R0140:Or4c126 UTSW 2 89,824,463 (GRCm39) missense probably damaging 1.00
R0220:Or4c126 UTSW 2 89,824,206 (GRCm39) missense probably benign 0.08
R0243:Or4c126 UTSW 2 89,824,150 (GRCm39) missense probably benign 0.01
R1644:Or4c126 UTSW 2 89,824,297 (GRCm39) missense possibly damaging 0.60
R1669:Or4c126 UTSW 2 89,824,144 (GRCm39) splice site probably null
R1916:Or4c126 UTSW 2 89,824,148 (GRCm39) missense probably benign
R3620:Or4c126 UTSW 2 89,824,196 (GRCm39) missense probably damaging 1.00
R4190:Or4c126 UTSW 2 89,823,918 (GRCm39) nonsense probably null
R5260:Or4c126 UTSW 2 89,824,526 (GRCm39) missense probably damaging 1.00
R5591:Or4c126 UTSW 2 89,823,751 (GRCm39) missense possibly damaging 0.95
R5907:Or4c126 UTSW 2 89,824,301 (GRCm39) missense probably benign 0.01
R5910:Or4c126 UTSW 2 89,823,782 (GRCm39) missense probably benign 0.29
R6044:Or4c126 UTSW 2 89,823,761 (GRCm39) missense possibly damaging 0.89
R6556:Or4c126 UTSW 2 89,824,517 (GRCm39) missense probably benign 0.39
R7083:Or4c126 UTSW 2 89,824,201 (GRCm39) missense probably benign
R8439:Or4c126 UTSW 2 89,824,348 (GRCm39) missense probably benign 0.31
R8745:Or4c126 UTSW 2 89,824,076 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTCAATGGCTGCATGACTC -3'
(R):5'- TTCTCAGGGAGCGAAGGATG -3'

Sequencing Primer
(F):5'- CATGACTCAGCTTTTTGTGGAGC -3'
(R):5'- GGATGACCACATAGGAAGCAACC -3'
Posted On 2019-10-07