Incidental Mutation 'R0628:Mertk'
ID57681
Institutional Source Beutler Lab
Gene Symbol Mertk
Ensembl Gene ENSMUSG00000014361
Gene Namec-mer proto-oncogene tyrosine kinase
SynonymsNyk, nmf12, Tyro 12, Eyk, Mer
MMRRC Submission 038817-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R0628 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location128698956-128802894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 128738313 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 229 (N229I)
Ref Sequence ENSEMBL: ENSMUSP00000014505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014505]
Predicted Effect probably damaging
Transcript: ENSMUST00000014505
AA Change: N229I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361
AA Change: N229I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 94 189 8.99e-6 SMART
IG 198 276 1.54e-4 SMART
FN3 279 363 7.23e-8 SMART
FN3 379 465 6.16e-2 SMART
transmembrane domain 498 520 N/A INTRINSIC
TyrKc 582 849 2.88e-129 SMART
Meta Mutation Damage Score 0.2661 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.6%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik T C 5: 109,678,576 probably null Het
Alpk2 A C 18: 65,307,296 V809G possibly damaging Het
Bank1 T A 3: 136,066,390 D493V probably damaging Het
Camk2d T C 3: 126,810,624 probably benign Het
Ccdc17 T A 4: 116,598,548 L292H probably damaging Het
Ccdc7b A G 8: 129,111,017 probably benign Het
Cd34 C A 1: 194,959,217 T317K probably damaging Het
Col6a5 C G 9: 105,912,450 probably null Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Copa T C 1: 172,091,025 probably benign Het
Coq7 T C 7: 118,529,644 D56G probably damaging Het
Dlg4 C T 11: 70,031,784 T201I probably damaging Het
Dnah7a T A 1: 53,497,105 D2593V probably benign Het
Ect2l T A 10: 18,143,040 E536V probably damaging Het
Emilin3 A G 2: 160,910,879 probably benign Het
Eml2 T C 7: 19,201,554 probably benign Het
Fam135b C T 15: 71,448,656 probably benign Het
Fam160b2 T C 14: 70,587,721 T392A possibly damaging Het
Gart C T 16: 91,633,902 R424H probably benign Het
Gm9745 T A 13: 8,940,922 probably benign Het
Gramd1a A G 7: 31,142,624 L80P probably damaging Het
Herc1 A G 9: 66,450,881 K2415E probably benign Het
Ica1 C T 6: 8,644,256 probably benign Het
Iyd A T 10: 3,547,127 M161L probably damaging Het
Kdm5a T C 6: 120,415,239 L974S probably damaging Het
Kif1a T C 1: 93,019,883 D1619G probably damaging Het
Lypd8 C T 11: 58,384,673 T78M probably damaging Het
March10 T A 11: 105,390,160 H433L probably benign Het
Mbp A G 18: 82,554,617 Y13C probably damaging Het
Msrb2 T A 2: 19,393,280 D116E probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Otoa G A 7: 121,145,650 probably benign Het
Pclo A G 5: 14,669,538 T1230A unknown Het
Polrmt T C 10: 79,739,145 T851A possibly damaging Het
Prpf6 C T 2: 181,636,048 P401L probably damaging Het
Rasgrp4 A G 7: 29,140,210 probably benign Het
Rc3h2 A T 2: 37,382,052 probably benign Het
Reps1 A G 10: 18,121,093 T588A probably damaging Het
Rtel1 A C 2: 181,351,881 S782R probably benign Het
Sacm1l A G 9: 123,548,995 probably benign Het
Skint5 A T 4: 113,731,069 L728* probably null Het
Slc9b2 T A 3: 135,323,775 probably benign Het
Snapc3 A T 4: 83,450,160 H298L probably benign Het
Tex9 A T 9: 72,491,951 M1K probably null Het
Trappc13 C T 13: 104,154,916 probably benign Het
Ttc37 G C 13: 76,150,729 V1185L possibly damaging Het
Usp3 C T 9: 66,518,444 R467H probably benign Het
Vmn2r11 T A 5: 109,047,731 L576F possibly damaging Het
Wnk4 T C 11: 101,275,023 F792S probably benign Het
Zfp280d T C 9: 72,361,948 V764A probably benign Het
Zfp69 G A 4: 120,949,425 Q4* probably null Het
Zfp692 T G 11: 58,309,623 L206R probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Zic4 T A 9: 91,384,117 Y264* probably null Het
Zic4 T A 9: 91,384,119 M272K probably benign Het
Zscan4b A T 7: 10,901,463 N284K probably damaging Het
Other mutations in Mertk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Mertk APN 2 128783967 missense probably damaging 1.00
IGL01561:Mertk APN 2 128736636 missense probably damaging 1.00
IGL01873:Mertk APN 2 128729275 missense possibly damaging 0.93
IGL02539:Mertk APN 2 128801290 missense probably damaging 1.00
IGL02652:Mertk APN 2 128801270 missense probably benign
IGL02962:Mertk APN 2 128777454 missense probably damaging 1.00
IGL03237:Mertk APN 2 128790272 missense probably damaging 1.00
PIT4378001:Mertk UTSW 2 128782617 critical splice donor site probably null
R0118:Mertk UTSW 2 128759166 missense probably damaging 0.99
R0281:Mertk UTSW 2 128782621 splice site probably benign
R0491:Mertk UTSW 2 128793107 critical splice donor site probably null
R0565:Mertk UTSW 2 128771483 missense probably benign 0.20
R1260:Mertk UTSW 2 128762152 missense probably benign 0.03
R1406:Mertk UTSW 2 128771486 missense probably benign 0.00
R1406:Mertk UTSW 2 128771486 missense probably benign 0.00
R1423:Mertk UTSW 2 128778963 missense probably damaging 1.00
R1523:Mertk UTSW 2 128790328 critical splice donor site probably null
R1539:Mertk UTSW 2 128782526 missense probably benign 0.05
R1680:Mertk UTSW 2 128801636 missense probably benign 0.03
R1770:Mertk UTSW 2 128750174 missense probably benign 0.10
R1832:Mertk UTSW 2 128762212 missense probably benign 0.10
R1870:Mertk UTSW 2 128801196 missense probably benign 0.01
R1959:Mertk UTSW 2 128759090 missense probably damaging 0.98
R2078:Mertk UTSW 2 128794458 missense probably damaging 1.00
R2125:Mertk UTSW 2 128762138 missense probably benign
R2178:Mertk UTSW 2 128793064 missense probably damaging 1.00
R2220:Mertk UTSW 2 128801472 missense probably benign 0.18
R4128:Mertk UTSW 2 128777438 nonsense probably null
R4664:Mertk UTSW 2 128801212 missense probably benign 0.24
R4740:Mertk UTSW 2 128751994 missense probably damaging 1.00
R4822:Mertk UTSW 2 128801305 missense probably benign 0.00
R4839:Mertk UTSW 2 128782576 missense probably damaging 0.97
R4874:Mertk UTSW 2 128750159 missense probably damaging 1.00
R4899:Mertk UTSW 2 128783925 missense probably damaging 1.00
R5010:Mertk UTSW 2 128784000 missense probably benign 0.03
R5128:Mertk UTSW 2 128738247 missense probably damaging 0.97
R5251:Mertk UTSW 2 128729455 missense probably damaging 1.00
R5276:Mertk UTSW 2 128801314 missense possibly damaging 0.87
R5397:Mertk UTSW 2 128771464 missense possibly damaging 0.86
R5575:Mertk UTSW 2 128736565 missense probably damaging 1.00
R5605:Mertk UTSW 2 128738307 missense probably benign 0.43
R5705:Mertk UTSW 2 128771401 missense probably benign 0.00
R5987:Mertk UTSW 2 128771374 missense probably benign 0.01
R6127:Mertk UTSW 2 128738291 missense probably damaging 0.99
R6556:Mertk UTSW 2 128776421 missense probably benign 0.23
R6671:Mertk UTSW 2 128752023 critical splice donor site probably null
R6674:Mertk UTSW 2 128729357 missense probably benign
R6841:Mertk UTSW 2 128759230 splice site probably null
R7153:Mertk UTSW 2 128736649 missense probably damaging 0.99
R7192:Mertk UTSW 2 128793108 splice site probably null
R7225:Mertk UTSW 2 128801562 missense possibly damaging 0.94
R7344:Mertk UTSW 2 128771497 missense probably benign
R7414:Mertk UTSW 2 128729393 missense possibly damaging 0.95
R7883:Mertk UTSW 2 128776345 missense probably benign 0.01
R8000:Mertk UTSW 2 128771498 missense probably benign
X0067:Mertk UTSW 2 128729567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTAAAGCATACTCTGCCCTGCTC -3'
(R):5'- TGTCAAGGGAGGCAACTGGACATC -3'

Sequencing Primer
(F):5'- TACTCTGCCCTGCTCTCTCTG -3'
(R):5'- CTTCTTGATTGACCACTGTTGG -3'
Posted On2013-07-11