Mutagenetix > Incidental Mutation

Incidental Mutation 'R7439:Exoc1'

576810

Institutional Source

Beutler Lab

Gene Symbol

Exoc1

Ensembl Gene

ENSMUSG00000036435

Gene Name

exocyst complex component 1

Synonyms

2810407P21Rik, Sec3p, SEC3, A730011E05Rik, Sec3l1

MMRRC Submission

045515-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7439 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

76529311-76570294 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 76545348 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 360 (N360K)

Ref Sequence

ENSEMBL: ENSMUSP00000109121 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049469] [ENSMUST00000087133] [ENSMUST00000113493]

AlphaFold

Q8R3S6

Predicted Effect

probably benign
Transcript: ENSMUST00000049469
AA Change: N353K

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000046719
Gene: ENSMUSG00000036435
AA Change: N353K

Domain	Start	End	E-Value	Type
Sec3-PIP2_bind	31	122	9.51e-41	SMART
Pfam:Sec3_C	169	856	5.5e-221	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000087133
AA Change: N353K

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000084373
Gene: ENSMUSG00000036435
AA Change: N353K

Domain	Start	End	E-Value	Type
Sec3-PIP2_bind	31	122	9.51e-41	SMART
Pfam:Sec3_C	169	871	2e-220	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113493
AA Change: N360K

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000109121
Gene: ENSMUSG00000036435
AA Change: N360K

Domain	Start	End	E-Value	Type
Sec3-PIP2_bind	31	122	9.51e-41	SMART
coiled coil region	161	183	N/A	INTRINSIC
Pfam:Sec3_C	190	878	4.1e-186	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality before implantation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530003J23Rik	G	A	10: 117,238,697		probably benign	Het
Acacb	T	C	5: 114,195,642	V542A	possibly damaging	Het
Adprhl1	C	T	8: 13,223,069	V1230I	probably benign	Het
Agpat1	T	A	17: 34,610,909	Y77N	probably damaging	Het
Apc	T	A	18: 34,312,073	I674K	probably damaging	Het
Arpc5	T	C	1: 152,771,436	S97P	probably damaging	Het
Arrdc5	A	G	17: 56,297,931	F119L	probably benign	Het
Asap1	A	G	15: 64,130,256	V402A	probably damaging	Het
Aspg	T	C	12: 112,124,821	V479A	possibly damaging	Het
B3galnt2	G	A	13: 13,994,485	V368M	probably benign	Het
Bcl3	T	C	7: 19,822,611	T23A	probably benign	Het
Bpifb5	A	G	2: 154,228,933	K215E	possibly damaging	Het
Coa4	T	A	7: 100,539,271	C64S	probably damaging	Het
Dcun1d4	T	C	5: 73,491,536		probably null	Het
Dnaaf5	T	G	5: 139,166,113	C506W	probably damaging	Het
Dock3	A	G	9: 107,023,732	Y345H	probably damaging	Het
Dscaml1	A	G	9: 45,710,326	N1024S	possibly damaging	Het
Dsp	T	C	13: 38,176,502		probably null	Het
Dsp	A	G	13: 38,195,449	T2057A	probably benign	Het
Dync1h1	T	G	12: 110,636,453	L2176R	probably damaging	Het
Eif5b	A	C	1: 38,051,637	D1192A	probably benign	Het
Epn2	A	T	11: 61,546,848		probably benign	Het
Fam135b	A	T	15: 71,463,680	V555E	probably damaging	Het
Fam208a	T	A	14: 27,471,645	V934E	probably damaging	Het
Fmn1	A	T	2: 113,441,611	Q108L	unknown	Het
Gcc2	A	G	10: 58,256,901	T48A	probably benign	Het
Gm438	T	C	4: 144,777,762	D273G	probably damaging	Het
Gm6619	T	G	6: 131,490,391	I73S	possibly damaging	Het
Gm8267	T	A	14: 44,722,940	D116V	probably damaging	Het
Hapln3	T	A	7: 79,117,269	T341S	probably benign	Het
Lamb3	C	A	1: 193,332,166	D544E	possibly damaging	Het
Lhx5	T	A	5: 120,440,284	S390T	probably benign	Het
Lrrc63	A	G	14: 75,126,257	S145P	possibly damaging	Het
Lrriq1	T	C	10: 103,214,519	M791V	probably benign	Het
Lyg2	A	G	1: 37,911,137	Y37H	possibly damaging	Het
Nrbp1	T	A	5: 31,244,956	M172K	probably damaging	Het
Olfr1044	T	A	2: 86,171,010	D269V	probably damaging	Het
Olfr1261	A	G	2: 89,993,839	I149V	probably benign	Het
Olfr168	T	G	16: 19,530,900	S7R	probably benign	Het
Pcyt2	A	T	11: 120,611,383	Y308N	possibly damaging	Het
Peg10	C	CTCA	6: 4,756,453		probably benign	Het
Phf21b	A	G	15: 84,804,903	S141P	probably damaging	Het
Pigh	G	A	12: 79,089,550	P24S	probably benign	Het
Plekhg3	A	G	12: 76,576,485	D834G	probably damaging	Het
Plekhg5	T	A	4: 152,113,935	V860D	probably benign	Het
Pon1	A	G	6: 5,177,399	I170T	probably damaging	Het
Ptpn9	T	A	9: 57,027,433	Y160*	probably null	Het
Ptprj	T	C	2: 90,449,819	K1045R	possibly damaging	Het
Rilpl2	T	A	5: 124,463,788	H196L	probably benign	Het
Rnf112	C	T	11: 61,451,028	V317I	possibly damaging	Het
Rundc3a	G	T	11: 102,400,046		probably null	Het
Sgsm1	T	C	5: 113,274,321	Y489C	probably damaging	Het
Sis	G	A	3: 72,909,041	H1531Y	possibly damaging	Het
Slc26a9	A	G	1: 131,762,818	Y520C	probably damaging	Het
Smc5	A	G	19: 23,242,700	V467A	probably damaging	Het
Spata20	G	A	11: 94,484,041	A245V	probably benign	Het
Steap3	A	C	1: 120,241,518	F350V	probably benign	Het
Sucnr1	A	G	3: 60,086,696	Q215R	probably benign	Het
Supv3l1	G	A	10: 62,430,615	A594V	probably damaging	Het
Swt1	A	T	1: 151,411,064	F226I	probably benign	Het
Taar7f	A	G	10: 24,049,987	T160A	possibly damaging	Het
Tada2a	A	T	11: 84,126,986		probably null	Het
Taok3	C	A	5: 117,250,909	Q460K	probably damaging	Het
Twf2	A	G	9: 106,214,398	E268G	probably damaging	Het
Upf2	A	T	2: 6,018,932	I698F	unknown	Het
Vmn2r35	T	A	7: 7,817,014	N86Y	probably damaging	Het
Vmn2r84	T	C	10: 130,392,113	T85A	possibly damaging	Het
Vps13d	A	G	4: 145,105,856	S2833P		Het
Xrn1	T	C	9: 96,051,629	S1584P	probably benign	Het
Zfp354b	T	C	11: 50,922,397	Y567C	probably damaging	Het
Zfp52	A	T	17: 21,560,870	R327*	probably null	Het

Other mutations in Exoc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00679:Exoc1	APN	5	76567023	missense	possibly damaging	0.88
IGL01149:Exoc1	APN	5	76542244	splice site	probably benign
IGL02061:Exoc1	APN	5	76542120	missense	probably damaging	0.96
IGL02288:Exoc1	APN	5	76545313	missense	probably benign
IGL02407:Exoc1	APN	5	76545346	missense	probably damaging	0.97
IGL03089:Exoc1	APN	5	76542158	missense	possibly damaging	0.81
IGL03242:Exoc1	APN	5	76559007	missense	probably damaging	1.00
IGL03348:Exoc1	APN	5	76535593	missense	probably damaging	1.00
IGL03411:Exoc1	APN	5	76542195	missense	probably damaging	1.00
Smalls	UTSW	5	76537779	missense	probably damaging	1.00
R0462:Exoc1	UTSW	5	76543617	missense	probably benign	0.37
R1216:Exoc1	UTSW	5	76554188	missense	probably benign
R1528:Exoc1	UTSW	5	76549564	missense	possibly damaging	0.94
R1531:Exoc1	UTSW	5	76559164	missense	probably damaging	0.98
R1636:Exoc1	UTSW	5	76568118	missense	probably benign	0.03
R1754:Exoc1	UTSW	5	76560322	splice site	probably null
R1803:Exoc1	UTSW	5	76561441	missense	probably benign	0.18
R2086:Exoc1	UTSW	5	76532846	nonsense	probably null
R2239:Exoc1	UTSW	5	76559710	unclassified	probably benign
R3914:Exoc1	UTSW	5	76543561	missense	possibly damaging	0.54
R4022:Exoc1	UTSW	5	76549570	missense	possibly damaging	0.92
R4329:Exoc1	UTSW	5	76567975	missense	probably damaging	1.00
R4413:Exoc1	UTSW	5	76542019	intron	probably benign
R4427:Exoc1	UTSW	5	76563263	missense	probably benign	0.00
R4557:Exoc1	UTSW	5	76561443	missense	probably damaging	1.00
R4627:Exoc1	UTSW	5	76542228	missense	probably benign	0.26
R4677:Exoc1	UTSW	5	76559163	missense	probably null	0.82
R5138:Exoc1	UTSW	5	76568075	missense	probably damaging	1.00
R5325:Exoc1	UTSW	5	76537702	missense	probably benign
R5342:Exoc1	UTSW	5	76567014	missense	probably damaging	1.00
R5736:Exoc1	UTSW	5	76537768	missense	possibly damaging	0.90
R5891:Exoc1	UTSW	5	76542144	missense	probably damaging	1.00
R6102:Exoc1	UTSW	5	76537779	missense	probably damaging	1.00
R6447:Exoc1	UTSW	5	76543517	missense	probably damaging	0.97
R6532:Exoc1	UTSW	5	76537837	missense	probably damaging	0.99
R6694:Exoc1	UTSW	5	76549552	missense	probably damaging	1.00
R6753:Exoc1	UTSW	5	76563339	missense	probably damaging	1.00
R6885:Exoc1	UTSW	5	76559042	missense	probably damaging	1.00
R7090:Exoc1	UTSW	5	76566953	missense	unknown
R7299:Exoc1	UTSW	5	76542159	missense	probably damaging	1.00
R7567:Exoc1	UTSW	5	76537715	missense	probably damaging	0.96
R7665:Exoc1	UTSW	5	76543573	missense	probably benign	0.33
R7745:Exoc1	UTSW	5	76561512	nonsense	probably null
R7883:Exoc1	UTSW	5	76561382	missense	probably damaging	0.99
R7918:Exoc1	UTSW	5	76543993	missense	probably benign	0.10
R7956:Exoc1	UTSW	5	76557857	missense	probably benign	0.01
R7977:Exoc1	UTSW	5	76543585	missense	probably damaging	1.00
R7987:Exoc1	UTSW	5	76543585	missense	probably damaging	1.00
R8191:Exoc1	UTSW	5	76559827	critical splice donor site	probably null
R8286:Exoc1	UTSW	5	76563240	missense	probably benign	0.00
R8670:Exoc1	UTSW	5	76569658	missense	probably damaging	1.00
R8791:Exoc1	UTSW	5	76535565	missense	probably damaging	1.00
R9308:Exoc1	UTSW	5	76559121	missense	probably benign	0.10
R9410:Exoc1	UTSW	5	76559142	missense	probably benign	0.21
R9717:Exoc1	UTSW	5	76563232	missense	probably benign	0.22
X0018:Exoc1	UTSW	5	76567035	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTGGTGAGCATAGTAATCACGG -3'
(R):5'- CGTCTGTGAGGAACTATGCAC -3'

Sequencing Primer
(F):5'- TTCTGGGACCCACGTAAAGGTG -3'
(R):5'- GTGAGGAACTATGCACAGATTTC -3'

Posted On

2019-10-07