Incidental Mutation 'R7439:Taok3'
ID576813
Institutional Source Beutler Lab
Gene Symbol Taok3
Ensembl Gene ENSMUSG00000061288
Gene NameTAO kinase 3
SynonymsA430105I05Rik, 2900006A08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7439 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location117120129-117275219 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 117250909 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 460 (Q460K)
Ref Sequence ENSEMBL: ENSMUSP00000107609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092889] [ENSMUST00000111975] [ENSMUST00000111978] [ENSMUST00000145640] [ENSMUST00000179276]
Predicted Effect probably damaging
Transcript: ENSMUST00000092889
AA Change: Q460K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000090565
Gene: ENSMUSG00000061288
AA Change: Q460K

DomainStartEndE-ValueType
S_TKc 24 277 4.4e-84 SMART
low complexity region 321 337 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
coiled coil region 452 495 N/A INTRINSIC
low complexity region 520 532 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
coiled coil region 618 649 N/A INTRINSIC
coiled coil region 789 869 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111975
SMART Domains Protein: ENSMUSP00000107606
Gene: ENSMUSG00000061288

DomainStartEndE-ValueType
coiled coil region 1 35 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 92 106 N/A INTRINSIC
coiled coil region 158 189 N/A INTRINSIC
coiled coil region 329 409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111978
AA Change: Q460K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107609
Gene: ENSMUSG00000061288
AA Change: Q460K

DomainStartEndE-ValueType
S_TKc 24 277 4.4e-84 SMART
low complexity region 321 337 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
coiled coil region 452 495 N/A INTRINSIC
low complexity region 520 532 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
coiled coil region 618 649 N/A INTRINSIC
coiled coil region 789 869 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000145640
AA Change: Q460K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116920
Gene: ENSMUSG00000061288
AA Change: Q460K

DomainStartEndE-ValueType
S_TKc 24 277 2.2e-86 SMART
low complexity region 321 337 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
coiled coil region 452 495 N/A INTRINSIC
low complexity region 520 532 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179276
AA Change: Q460K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136750
Gene: ENSMUSG00000061288
AA Change: Q460K

DomainStartEndE-ValueType
S_TKc 24 277 4.4e-84 SMART
low complexity region 321 337 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
coiled coil region 452 495 N/A INTRINSIC
low complexity region 520 532 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
coiled coil region 618 649 N/A INTRINSIC
coiled coil region 789 869 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase that activates the p38/MAPK14 stress-activated MAPK cascade but inhibits the basal activity of the MAPK8/JNK cascade. The encoded protein is a member of the GCK subfamily of STE20-like kinases. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530003J23Rik G A 10: 117,238,697 probably benign Het
Acacb T C 5: 114,195,642 V542A possibly damaging Het
Adprhl1 C T 8: 13,223,069 V1230I probably benign Het
Agpat1 T A 17: 34,610,909 Y77N probably damaging Het
Apc T A 18: 34,312,073 I674K probably damaging Het
Arpc5 T C 1: 152,771,436 S97P probably damaging Het
Arrdc5 A G 17: 56,297,931 F119L probably benign Het
Asap1 A G 15: 64,130,256 V402A probably damaging Het
Aspg T C 12: 112,124,821 V479A possibly damaging Het
B3galnt2 G A 13: 13,994,485 V368M probably benign Het
Bcl3 T C 7: 19,822,611 T23A probably benign Het
Bpifb5 A G 2: 154,228,933 K215E possibly damaging Het
Coa4 T A 7: 100,539,271 C64S probably damaging Het
Dcun1d4 T C 5: 73,491,536 probably null Het
Dnaaf5 T G 5: 139,166,113 C506W probably damaging Het
Dock3 A G 9: 107,023,732 Y345H probably damaging Het
Dscaml1 A G 9: 45,710,326 N1024S possibly damaging Het
Dsp T C 13: 38,176,502 probably null Het
Dsp A G 13: 38,195,449 T2057A probably benign Het
Dync1h1 T G 12: 110,636,453 L2176R probably damaging Het
Eif5b A C 1: 38,051,637 D1192A probably benign Het
Epn2 A T 11: 61,546,848 probably benign Het
Exoc1 T A 5: 76,545,348 N360K probably benign Het
Fam135b A T 15: 71,463,680 V555E probably damaging Het
Fam208a T A 14: 27,471,645 V934E probably damaging Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Gcc2 A G 10: 58,256,901 T48A probably benign Het
Gm438 T C 4: 144,777,762 D273G probably damaging Het
Gm6619 T G 6: 131,490,391 I73S possibly damaging Het
Gm8267 T A 14: 44,722,940 D116V probably damaging Het
Hapln3 T A 7: 79,117,269 T341S probably benign Het
Lamb3 C A 1: 193,332,166 D544E possibly damaging Het
Lhx5 T A 5: 120,440,284 S390T probably benign Het
Lrrc63 A G 14: 75,126,257 S145P possibly damaging Het
Lrriq1 T C 10: 103,214,519 M791V probably benign Het
Lyg2 A G 1: 37,911,137 Y37H possibly damaging Het
Nrbp1 T A 5: 31,244,956 M172K probably damaging Het
Olfr1044 T A 2: 86,171,010 D269V probably damaging Het
Olfr1261 A G 2: 89,993,839 I149V probably benign Het
Olfr168 T G 16: 19,530,900 S7R probably benign Het
Pcyt2 A T 11: 120,611,383 Y308N possibly damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Phf21b A G 15: 84,804,903 S141P probably damaging Het
Pigh G A 12: 79,089,550 P24S probably benign Het
Plekhg3 A G 12: 76,576,485 D834G probably damaging Het
Plekhg5 T A 4: 152,113,935 V860D probably benign Het
Pon1 A G 6: 5,177,399 I170T probably damaging Het
Ptpn9 T A 9: 57,027,433 Y160* probably null Het
Ptprj T C 2: 90,449,819 K1045R possibly damaging Het
Rilpl2 T A 5: 124,463,788 H196L probably benign Het
Rnf112 C T 11: 61,451,028 V317I possibly damaging Het
Rundc3a G T 11: 102,400,046 probably null Het
Sgsm1 T C 5: 113,274,321 Y489C probably damaging Het
Sis G A 3: 72,909,041 H1531Y possibly damaging Het
Slc26a9 A G 1: 131,762,818 Y520C probably damaging Het
Smc5 A G 19: 23,242,700 V467A probably damaging Het
Spata20 G A 11: 94,484,041 A245V probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Sucnr1 A G 3: 60,086,696 Q215R probably benign Het
Supv3l1 G A 10: 62,430,615 A594V probably damaging Het
Swt1 A T 1: 151,411,064 F226I probably benign Het
Taar7f A G 10: 24,049,987 T160A possibly damaging Het
Tada2a A T 11: 84,126,986 probably null Het
Twf2 A G 9: 106,214,398 E268G probably damaging Het
Upf2 A T 2: 6,018,932 I698F unknown Het
Vmn2r35 T A 7: 7,817,014 N86Y probably damaging Het
Vmn2r84 T C 10: 130,392,113 T85A possibly damaging Het
Vps13d A G 4: 145,105,856 S2833P Het
Xrn1 T C 9: 96,051,629 S1584P probably benign Het
Zfp354b T C 11: 50,922,397 Y567C probably damaging Het
Zfp52 A T 17: 21,560,870 R327* probably null Het
Other mutations in Taok3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Taok3 APN 5 117272197 missense probably benign 0.20
IGL01632:Taok3 APN 5 117265928 missense possibly damaging 0.95
IGL02894:Taok3 APN 5 117263613 missense probably benign 0.19
bonze UTSW 5 117272229 nonsense probably null
daoist UTSW 5 117209571 missense probably damaging 0.99
haller UTSW 5 117206655 missense probably damaging 1.00
Perseveration UTSW 5 117255863 missense probably benign 0.25
taoist UTSW 5 117206655 missense probably damaging 1.00
Three_treasures UTSW 5 117217242 critical splice donor site probably null
PIT4366001:Taok3 UTSW 5 117227985 missense probably benign 0.21
R0046:Taok3 UTSW 5 117272229 nonsense probably null
R0046:Taok3 UTSW 5 117272229 nonsense probably null
R0158:Taok3 UTSW 5 117217242 critical splice donor site probably null
R0245:Taok3 UTSW 5 117252679 splice site probably benign
R0371:Taok3 UTSW 5 117206687 nonsense probably null
R1140:Taok3 UTSW 5 117228053 missense possibly damaging 0.94
R1302:Taok3 UTSW 5 117199043 missense possibly damaging 0.46
R1376:Taok3 UTSW 5 117265961 missense probably damaging 1.00
R1376:Taok3 UTSW 5 117265961 missense probably damaging 1.00
R1387:Taok3 UTSW 5 117206655 missense probably damaging 1.00
R1711:Taok3 UTSW 5 117255926 missense possibly damaging 0.68
R1977:Taok3 UTSW 5 117265924 missense probably damaging 0.98
R2898:Taok3 UTSW 5 117200069 critical splice acceptor site probably null
R3824:Taok3 UTSW 5 117255937 missense probably benign 0.01
R4378:Taok3 UTSW 5 117209571 missense probably damaging 0.99
R4695:Taok3 UTSW 5 117228066 missense probably benign 0.11
R4882:Taok3 UTSW 5 117252630 missense probably damaging 0.99
R5286:Taok3 UTSW 5 117266075 missense probably damaging 1.00
R5522:Taok3 UTSW 5 117273757 missense probably benign 0.00
R5562:Taok3 UTSW 5 117250964 missense probably damaging 1.00
R5643:Taok3 UTSW 5 117206720 missense probably benign
R6241:Taok3 UTSW 5 117272197 missense probably benign 0.33
R6290:Taok3 UTSW 5 117204368 missense probably damaging 1.00
R6310:Taok3 UTSW 5 117255938 missense possibly damaging 0.48
R6339:Taok3 UTSW 5 117228030 missense probably benign
R6717:Taok3 UTSW 5 117240950 intron probably benign
R6721:Taok3 UTSW 5 117255863 missense probably benign 0.25
R6755:Taok3 UTSW 5 117206667 missense probably damaging 1.00
R7046:Taok3 UTSW 5 117273706 missense probably damaging 1.00
R7053:Taok3 UTSW 5 117252562 missense probably benign 0.00
R7259:Taok3 UTSW 5 117252543 missense probably benign 0.00
R7308:Taok3 UTSW 5 117200151 nonsense probably null
R7732:Taok3 UTSW 5 117193748 missense possibly damaging 0.53
R7758:Taok3 UTSW 5 117250907 missense probably damaging 1.00
R7939:Taok3 UTSW 5 117193837 missense probably benign 0.01
R8412:Taok3 UTSW 5 117266037 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- AGCAACATCTGGAGGCTTGG -3'
(R):5'- ATGATGTCAGATGGGACCCC -3'

Sequencing Primer
(F):5'- TTGGAAGCCACAGTGTCC -3'
(R):5'- ATCTCAGCCTTCAGCTTG -3'
Posted On2019-10-07