Incidental Mutation 'R7439:Lhx5'
ID 576814
Institutional Source Beutler Lab
Gene Symbol Lhx5
Ensembl Gene ENSMUSG00000029595
Gene Name LIM homeobox protein 5
Synonyms Lim2
MMRRC Submission 045515-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.800) question?
Stock # R7439 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 120431699-120441223 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 120440284 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 390 (S390T)
Ref Sequence ENSEMBL: ENSMUSP00000031591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031591]
AlphaFold P61375
Predicted Effect probably benign
Transcript: ENSMUST00000031591
AA Change: S390T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000031591
Gene: ENSMUSG00000029595
AA Change: S390T

DomainStartEndE-ValueType
LIM 4 55 1.7e-17 SMART
LIM 63 118 3e-18 SMART
low complexity region 120 135 N/A INTRINSIC
low complexity region 140 153 N/A INTRINSIC
HOX 180 242 1.33e-22 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 300 311 N/A INTRINSIC
low complexity region 322 336 N/A INTRINSIC
low complexity region 370 384 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to a large protein family, members of which carry the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein may function as a transcriptional regulator and be involved in the control of differentiation and development of the forebrain. In mice, this protein is essential for the regulation of precursor cell proliferation and the control of neuronal differentiation and migration during hippocampal development. This protein is involved in learning and motor functions in adult mice. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most mice homozygous for a null mutation display defective hippocampal development and die within a few days after birth. Postmitotic hippocampal cells are unable to differentiate properly and migrate to correct positions, resulting in structural anomalies of the Ammon's horn and the dentate gyrus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530003J23Rik G A 10: 117,238,697 probably benign Het
Acacb T C 5: 114,195,642 V542A possibly damaging Het
Adprhl1 C T 8: 13,223,069 V1230I probably benign Het
Agpat1 T A 17: 34,610,909 Y77N probably damaging Het
Apc T A 18: 34,312,073 I674K probably damaging Het
Arpc5 T C 1: 152,771,436 S97P probably damaging Het
Arrdc5 A G 17: 56,297,931 F119L probably benign Het
Asap1 A G 15: 64,130,256 V402A probably damaging Het
Aspg T C 12: 112,124,821 V479A possibly damaging Het
B3galnt2 G A 13: 13,994,485 V368M probably benign Het
Bcl3 T C 7: 19,822,611 T23A probably benign Het
Bpifb5 A G 2: 154,228,933 K215E possibly damaging Het
Coa4 T A 7: 100,539,271 C64S probably damaging Het
Dcun1d4 T C 5: 73,491,536 probably null Het
Dnaaf5 T G 5: 139,166,113 C506W probably damaging Het
Dock3 A G 9: 107,023,732 Y345H probably damaging Het
Dscaml1 A G 9: 45,710,326 N1024S possibly damaging Het
Dsp T C 13: 38,176,502 probably null Het
Dsp A G 13: 38,195,449 T2057A probably benign Het
Dync1h1 T G 12: 110,636,453 L2176R probably damaging Het
Eif5b A C 1: 38,051,637 D1192A probably benign Het
Epn2 A T 11: 61,546,848 probably benign Het
Exoc1 T A 5: 76,545,348 N360K probably benign Het
Fam135b A T 15: 71,463,680 V555E probably damaging Het
Fam208a T A 14: 27,471,645 V934E probably damaging Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Gcc2 A G 10: 58,256,901 T48A probably benign Het
Gm438 T C 4: 144,777,762 D273G probably damaging Het
Gm6619 T G 6: 131,490,391 I73S possibly damaging Het
Gm8267 T A 14: 44,722,940 D116V probably damaging Het
Hapln3 T A 7: 79,117,269 T341S probably benign Het
Lamb3 C A 1: 193,332,166 D544E possibly damaging Het
Lrrc63 A G 14: 75,126,257 S145P possibly damaging Het
Lrriq1 T C 10: 103,214,519 M791V probably benign Het
Lyg2 A G 1: 37,911,137 Y37H possibly damaging Het
Nrbp1 T A 5: 31,244,956 M172K probably damaging Het
Olfr1044 T A 2: 86,171,010 D269V probably damaging Het
Olfr1261 A G 2: 89,993,839 I149V probably benign Het
Olfr168 T G 16: 19,530,900 S7R probably benign Het
Pcyt2 A T 11: 120,611,383 Y308N possibly damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Phf21b A G 15: 84,804,903 S141P probably damaging Het
Pigh G A 12: 79,089,550 P24S probably benign Het
Plekhg3 A G 12: 76,576,485 D834G probably damaging Het
Plekhg5 T A 4: 152,113,935 V860D probably benign Het
Pon1 A G 6: 5,177,399 I170T probably damaging Het
Ptpn9 T A 9: 57,027,433 Y160* probably null Het
Ptprj T C 2: 90,449,819 K1045R possibly damaging Het
Rilpl2 T A 5: 124,463,788 H196L probably benign Het
Rnf112 C T 11: 61,451,028 V317I possibly damaging Het
Rundc3a G T 11: 102,400,046 probably null Het
Sgsm1 T C 5: 113,274,321 Y489C probably damaging Het
Sis G A 3: 72,909,041 H1531Y possibly damaging Het
Slc26a9 A G 1: 131,762,818 Y520C probably damaging Het
Smc5 A G 19: 23,242,700 V467A probably damaging Het
Spata20 G A 11: 94,484,041 A245V probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Sucnr1 A G 3: 60,086,696 Q215R probably benign Het
Supv3l1 G A 10: 62,430,615 A594V probably damaging Het
Swt1 A T 1: 151,411,064 F226I probably benign Het
Taar7f A G 10: 24,049,987 T160A possibly damaging Het
Tada2a A T 11: 84,126,986 probably null Het
Taok3 C A 5: 117,250,909 Q460K probably damaging Het
Twf2 A G 9: 106,214,398 E268G probably damaging Het
Upf2 A T 2: 6,018,932 I698F unknown Het
Vmn2r35 T A 7: 7,817,014 N86Y probably damaging Het
Vmn2r84 T C 10: 130,392,113 T85A possibly damaging Het
Vps13d A G 4: 145,105,856 S2833P Het
Xrn1 T C 9: 96,051,629 S1584P probably benign Het
Zfp354b T C 11: 50,922,397 Y567C probably damaging Het
Zfp52 A T 17: 21,560,870 R327* probably null Het
Other mutations in Lhx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1793:Lhx5 UTSW 5 120434660 missense probably damaging 1.00
R2958:Lhx5 UTSW 5 120435477 missense probably benign 0.09
R3019:Lhx5 UTSW 5 120440005 missense probably benign 0.02
R4504:Lhx5 UTSW 5 120440008 missense possibly damaging 0.92
R4505:Lhx5 UTSW 5 120440008 missense possibly damaging 0.92
R4507:Lhx5 UTSW 5 120440008 missense possibly damaging 0.92
R4508:Lhx5 UTSW 5 120435434 missense probably damaging 0.99
R4671:Lhx5 UTSW 5 120439967 missense probably benign 0.01
R4769:Lhx5 UTSW 5 120436438 missense probably benign 0.22
R5547:Lhx5 UTSW 5 120434610 missense probably benign 0.32
R7122:Lhx5 UTSW 5 120436345 missense probably benign 0.35
R8911:Lhx5 UTSW 5 120436444 nonsense probably null
R9168:Lhx5 UTSW 5 120432345 missense probably benign 0.11
R9197:Lhx5 UTSW 5 120435381 missense possibly damaging 0.52
R9293:Lhx5 UTSW 5 120432386 missense probably benign 0.05
R9701:Lhx5 UTSW 5 120434598 missense possibly damaging 0.95
R9802:Lhx5 UTSW 5 120434598 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CGGGAGGCAATTACGATTTCTTC -3'
(R):5'- TTGACTTTGGTCCCGAGAAATTG -3'

Sequencing Primer
(F):5'- CGATTTCTTCGCGCACGG -3'
(R):5'- TCCCGAGAAATTGCGCAG -3'
Posted On 2019-10-07