Incidental Mutation 'R7439:Dnaaf5'
ID576816
Institutional Source Beutler Lab
Gene Symbol Dnaaf5
Ensembl Gene ENSMUSG00000025857
Gene Namedynein, axonemal assembly factor 5
SynonymsHeatr2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R7439 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location139150223-139186510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 139166113 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tryptophan at position 506 (C506W)
Ref Sequence ENSEMBL: ENSMUSP00000026975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026975] [ENSMUST00000196441]
Predicted Effect probably damaging
Transcript: ENSMUST00000026975
AA Change: C506W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026975
Gene: ENSMUSG00000025857
AA Change: C506W

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
low complexity region 73 83 N/A INTRINSIC
low complexity region 91 153 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
Pfam:Vac14_Fab1_bd 673 770 2.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196441
AA Change: C211W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142924
Gene: ENSMUSG00000025857
AA Change: C211W

DomainStartEndE-ValueType
Pfam:Vac14_Fab1_bd 378 475 4.1e-5 PFAM
Pfam:HEAT 447 477 1.7e-3 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is essential for the preassembly or stability of axonemal dynein arms, and is found only in organisms with motile cilia and flagella. Mutations in this gene are associated with primary ciliary dyskinesia-18, a disorder characterized by abnormalities of motile cilia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2013]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530003J23Rik G A 10: 117,238,697 probably benign Het
Acacb T C 5: 114,195,642 V542A possibly damaging Het
Adprhl1 C T 8: 13,223,069 V1230I probably benign Het
Agpat1 T A 17: 34,610,909 Y77N probably damaging Het
Apc T A 18: 34,312,073 I674K probably damaging Het
Arpc5 T C 1: 152,771,436 S97P probably damaging Het
Arrdc5 A G 17: 56,297,931 F119L probably benign Het
Asap1 A G 15: 64,130,256 V402A probably damaging Het
Aspg T C 12: 112,124,821 V479A possibly damaging Het
B3galnt2 G A 13: 13,994,485 V368M probably benign Het
Bcl3 T C 7: 19,822,611 T23A probably benign Het
Bpifb5 A G 2: 154,228,933 K215E possibly damaging Het
Coa4 T A 7: 100,539,271 C64S probably damaging Het
Dcun1d4 T C 5: 73,491,536 probably null Het
Dock3 A G 9: 107,023,732 Y345H probably damaging Het
Dscaml1 A G 9: 45,710,326 N1024S possibly damaging Het
Dsp T C 13: 38,176,502 probably null Het
Dsp A G 13: 38,195,449 T2057A probably benign Het
Dync1h1 T G 12: 110,636,453 L2176R probably damaging Het
Eif5b A C 1: 38,051,637 D1192A probably benign Het
Epn2 A T 11: 61,546,848 probably benign Het
Exoc1 T A 5: 76,545,348 N360K probably benign Het
Fam135b A T 15: 71,463,680 V555E probably damaging Het
Fam208a T A 14: 27,471,645 V934E probably damaging Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Gcc2 A G 10: 58,256,901 T48A probably benign Het
Gm438 T C 4: 144,777,762 D273G probably damaging Het
Gm6619 T G 6: 131,490,391 I73S possibly damaging Het
Gm8267 T A 14: 44,722,940 D116V probably damaging Het
Hapln3 T A 7: 79,117,269 T341S probably benign Het
Lamb3 C A 1: 193,332,166 D544E possibly damaging Het
Lhx5 T A 5: 120,440,284 S390T probably benign Het
Lrrc63 A G 14: 75,126,257 S145P possibly damaging Het
Lrriq1 T C 10: 103,214,519 M791V probably benign Het
Lyg2 A G 1: 37,911,137 Y37H possibly damaging Het
Nrbp1 T A 5: 31,244,956 M172K probably damaging Het
Olfr1044 T A 2: 86,171,010 D269V probably damaging Het
Olfr1261 A G 2: 89,993,839 I149V probably benign Het
Olfr168 T G 16: 19,530,900 S7R probably benign Het
Pcyt2 A T 11: 120,611,383 Y308N possibly damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Phf21b A G 15: 84,804,903 S141P probably damaging Het
Pigh G A 12: 79,089,550 P24S probably benign Het
Plekhg3 A G 12: 76,576,485 D834G probably damaging Het
Plekhg5 T A 4: 152,113,935 V860D probably benign Het
Pon1 A G 6: 5,177,399 I170T probably damaging Het
Ptpn9 T A 9: 57,027,433 Y160* probably null Het
Ptprj T C 2: 90,449,819 K1045R possibly damaging Het
Rilpl2 T A 5: 124,463,788 H196L probably benign Het
Rnf112 C T 11: 61,451,028 V317I possibly damaging Het
Rundc3a G T 11: 102,400,046 probably null Het
Sgsm1 T C 5: 113,274,321 Y489C probably damaging Het
Sis G A 3: 72,909,041 H1531Y possibly damaging Het
Slc26a9 A G 1: 131,762,818 Y520C probably damaging Het
Smc5 A G 19: 23,242,700 V467A probably damaging Het
Spata20 G A 11: 94,484,041 A245V probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Sucnr1 A G 3: 60,086,696 Q215R probably benign Het
Supv3l1 G A 10: 62,430,615 A594V probably damaging Het
Swt1 A T 1: 151,411,064 F226I probably benign Het
Taar7f A G 10: 24,049,987 T160A possibly damaging Het
Tada2a A T 11: 84,126,986 probably null Het
Taok3 C A 5: 117,250,909 Q460K probably damaging Het
Twf2 A G 9: 106,214,398 E268G probably damaging Het
Upf2 A T 2: 6,018,932 I698F unknown Het
Vmn2r35 T A 7: 7,817,014 N86Y probably damaging Het
Vmn2r84 T C 10: 130,392,113 T85A possibly damaging Het
Vps13d A G 4: 145,105,856 S2833P Het
Xrn1 T C 9: 96,051,629 S1584P probably benign Het
Zfp354b T C 11: 50,922,397 Y567C probably damaging Het
Zfp52 A T 17: 21,560,870 R327* probably null Het
Other mutations in Dnaaf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Dnaaf5 APN 5 139177946 missense probably benign 0.19
IGL00730:Dnaaf5 APN 5 139151668 critical splice donor site probably null
IGL01468:Dnaaf5 APN 5 139151480 splice site probably null
IGL02106:Dnaaf5 APN 5 139151513 missense probably damaging 1.00
IGL02273:Dnaaf5 APN 5 139177916 nonsense probably null
IGL02514:Dnaaf5 APN 5 139174117 splice site probably benign
IGL02572:Dnaaf5 APN 5 139184629 missense probably benign 0.00
IGL02699:Dnaaf5 APN 5 139153350 splice site probably benign
PIT4142001:Dnaaf5 UTSW 5 139185518 missense possibly damaging 0.91
PIT4283001:Dnaaf5 UTSW 5 139166162 missense probably benign 0.26
R0458:Dnaaf5 UTSW 5 139161878 missense possibly damaging 0.47
R2060:Dnaaf5 UTSW 5 139178003 missense probably damaging 1.00
R2162:Dnaaf5 UTSW 5 139181565 missense possibly damaging 0.46
R3833:Dnaaf5 UTSW 5 139181565 missense possibly damaging 0.46
R3944:Dnaaf5 UTSW 5 139152924 start gained probably benign
R4438:Dnaaf5 UTSW 5 139163392 missense probably damaging 1.00
R4534:Dnaaf5 UTSW 5 139151527 nonsense probably null
R4576:Dnaaf5 UTSW 5 139185639 missense probably damaging 0.98
R4581:Dnaaf5 UTSW 5 139184685 missense probably damaging 1.00
R4715:Dnaaf5 UTSW 5 139178000 missense probably damaging 0.99
R4791:Dnaaf5 UTSW 5 139184650 missense possibly damaging 0.56
R4868:Dnaaf5 UTSW 5 139170186 missense probably benign 0.01
R5011:Dnaaf5 UTSW 5 139163257 missense probably damaging 1.00
R5074:Dnaaf5 UTSW 5 139174207 missense probably damaging 1.00
R5137:Dnaaf5 UTSW 5 139181460 missense probably damaging 1.00
R5215:Dnaaf5 UTSW 5 139161877 missense probably benign 0.00
R5309:Dnaaf5 UTSW 5 139152862 missense probably damaging 0.99
R5312:Dnaaf5 UTSW 5 139152862 missense probably damaging 0.99
R6632:Dnaaf5 UTSW 5 139170333 missense probably benign 0.04
R6863:Dnaaf5 UTSW 5 139151596 missense probably damaging 0.96
R7292:Dnaaf5 UTSW 5 139150317 missense unknown
R7571:Dnaaf5 UTSW 5 139170208 missense possibly damaging 0.73
R7679:Dnaaf5 UTSW 5 139150637 missense unknown
R7706:Dnaaf5 UTSW 5 139152841 missense probably damaging 1.00
R7867:Dnaaf5 UTSW 5 139161810 missense probably damaging 1.00
R8191:Dnaaf5 UTSW 5 139181495 missense probably benign 0.06
X0020:Dnaaf5 UTSW 5 139163320 missense probably damaging 0.99
Z1177:Dnaaf5 UTSW 5 139177975 missense probably damaging 1.00
Z1177:Dnaaf5 UTSW 5 139185542 missense probably benign 0.04
Z1177:Dnaaf5 UTSW 5 139185585 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAAGCTTCCCTGTTGGC -3'
(R):5'- CAGGTGTGAAATTCAACCATGC -3'

Sequencing Primer
(F):5'- CTGTGTTCAGGTCAAGGCC -3'
(R):5'- GGTGTGAAATTCAACCATGCTAAAG -3'
Posted On2019-10-07