Incidental Mutation 'R7439:Bcl3'
ID576821
Institutional Source Beutler Lab
Gene Symbol Bcl3
Ensembl Gene ENSMUSG00000053175
Gene NameB cell leukemia/lymphoma 3
SynonymsBcl-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7439 (G1)
Quality Score176.009
Status Not validated
Chromosome7
Chromosomal Location19808462-19822770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19822611 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 23 (T23A)
Ref Sequence ENSEMBL: ENSMUSP00000113851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120537]
Predicted Effect probably benign
Transcript: ENSMUST00000120537
AA Change: T23A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113851
Gene: ENSMUSG00000053175
AA Change: T23A

DomainStartEndE-ValueType
ANK 129 162 4.01e0 SMART
ANK 166 195 4.43e-2 SMART
ANK 199 230 8.99e-3 SMART
ANK 236 265 3.23e-4 SMART
ANK 270 299 5.79e-6 SMART
ANK 303 332 1.4e1 SMART
low complexity region 377 402 N/A INTRINSIC
low complexity region 425 447 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a proto-oncogene candidate. It is identified by its translocation into the immunoglobulin alpha-locus in some cases of B-cell leukemia. The protein encoded by this gene contains seven ankyrin repeats, which are most closely related to those found in I kappa B proteins. This protein functions as a transcriptional co-activator that activates through its association with NF-kappa B homodimers. The expression of this gene can be induced by NF-kappa B, which forms a part of the autoregulatory loop that controls the nuclear residence of p50 NF-kappa B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice lacking functional copies of this gene exhibit defects of the immune system including disruption of the humoral immune response and abnormal spleen and Peyer's patch organogenesis. Mutant mice show increased susceptibility to pathogens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530003J23Rik G A 10: 117,238,697 probably benign Het
Acacb T C 5: 114,195,642 V542A possibly damaging Het
Adprhl1 C T 8: 13,223,069 V1230I probably benign Het
Agpat1 T A 17: 34,610,909 Y77N probably damaging Het
Apc T A 18: 34,312,073 I674K probably damaging Het
Arpc5 T C 1: 152,771,436 S97P probably damaging Het
Arrdc5 A G 17: 56,297,931 F119L probably benign Het
Asap1 A G 15: 64,130,256 V402A probably damaging Het
Aspg T C 12: 112,124,821 V479A possibly damaging Het
B3galnt2 G A 13: 13,994,485 V368M probably benign Het
Bpifb5 A G 2: 154,228,933 K215E possibly damaging Het
Coa4 T A 7: 100,539,271 C64S probably damaging Het
Dcun1d4 T C 5: 73,491,536 probably null Het
Dnaaf5 T G 5: 139,166,113 C506W probably damaging Het
Dock3 A G 9: 107,023,732 Y345H probably damaging Het
Dscaml1 A G 9: 45,710,326 N1024S possibly damaging Het
Dsp T C 13: 38,176,502 probably null Het
Dsp A G 13: 38,195,449 T2057A probably benign Het
Dync1h1 T G 12: 110,636,453 L2176R probably damaging Het
Eif5b A C 1: 38,051,637 D1192A probably benign Het
Epn2 A T 11: 61,546,848 probably benign Het
Exoc1 T A 5: 76,545,348 N360K probably benign Het
Fam135b A T 15: 71,463,680 V555E probably damaging Het
Fam208a T A 14: 27,471,645 V934E probably damaging Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Gcc2 A G 10: 58,256,901 T48A probably benign Het
Gm438 T C 4: 144,777,762 D273G probably damaging Het
Gm6619 T G 6: 131,490,391 I73S possibly damaging Het
Gm8267 T A 14: 44,722,940 D116V probably damaging Het
Hapln3 T A 7: 79,117,269 T341S probably benign Het
Lamb3 C A 1: 193,332,166 D544E possibly damaging Het
Lhx5 T A 5: 120,440,284 S390T probably benign Het
Lrrc63 A G 14: 75,126,257 S145P possibly damaging Het
Lrriq1 T C 10: 103,214,519 M791V probably benign Het
Lyg2 A G 1: 37,911,137 Y37H possibly damaging Het
Nrbp1 T A 5: 31,244,956 M172K probably damaging Het
Olfr1044 T A 2: 86,171,010 D269V probably damaging Het
Olfr1261 A G 2: 89,993,839 I149V probably benign Het
Olfr168 T G 16: 19,530,900 S7R probably benign Het
Pcyt2 A T 11: 120,611,383 Y308N possibly damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Phf21b A G 15: 84,804,903 S141P probably damaging Het
Pigh G A 12: 79,089,550 P24S probably benign Het
Plekhg3 A G 12: 76,576,485 D834G probably damaging Het
Plekhg5 T A 4: 152,113,935 V860D probably benign Het
Pon1 A G 6: 5,177,399 I170T probably damaging Het
Ptpn9 T A 9: 57,027,433 Y160* probably null Het
Ptprj T C 2: 90,449,819 K1045R possibly damaging Het
Rilpl2 T A 5: 124,463,788 H196L probably benign Het
Rnf112 C T 11: 61,451,028 V317I possibly damaging Het
Rundc3a G T 11: 102,400,046 probably null Het
Sgsm1 T C 5: 113,274,321 Y489C probably damaging Het
Sis G A 3: 72,909,041 H1531Y possibly damaging Het
Slc26a9 A G 1: 131,762,818 Y520C probably damaging Het
Smc5 A G 19: 23,242,700 V467A probably damaging Het
Spata20 G A 11: 94,484,041 A245V probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Sucnr1 A G 3: 60,086,696 Q215R probably benign Het
Supv3l1 G A 10: 62,430,615 A594V probably damaging Het
Swt1 A T 1: 151,411,064 F226I probably benign Het
Taar7f A G 10: 24,049,987 T160A possibly damaging Het
Tada2a A T 11: 84,126,986 probably null Het
Taok3 C A 5: 117,250,909 Q460K probably damaging Het
Twf2 A G 9: 106,214,398 E268G probably damaging Het
Upf2 A T 2: 6,018,932 I698F unknown Het
Vmn2r35 T A 7: 7,817,014 N86Y probably damaging Het
Vmn2r84 T C 10: 130,392,113 T85A possibly damaging Het
Vps13d A G 4: 145,105,856 S2833P Het
Xrn1 T C 9: 96,051,629 S1584P probably benign Het
Zfp354b T C 11: 50,922,397 Y567C probably damaging Het
Zfp52 A T 17: 21,560,870 R327* probably null Het
Other mutations in Bcl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Bcl3 APN 7 19809614 missense probably damaging 1.00
IGL01669:Bcl3 APN 7 19812491 nonsense probably null
IGL03024:Bcl3 APN 7 19809134 splice site probably benign
Memorial UTSW 7 19812484 missense probably damaging 1.00
sunrise UTSW 7 19811580 nonsense probably null
sunrise2 UTSW 7 19809634 nonsense probably null
R0124:Bcl3 UTSW 7 19809651 missense probably damaging 1.00
R0136:Bcl3 UTSW 7 19809569 missense probably damaging 1.00
R0554:Bcl3 UTSW 7 19820066 missense probably benign 0.26
R1845:Bcl3 UTSW 7 19809627 missense probably damaging 0.98
R2571:Bcl3 UTSW 7 19809527 missense probably damaging 1.00
R4355:Bcl3 UTSW 7 19811580 nonsense probably null
R4597:Bcl3 UTSW 7 19812503 missense probably damaging 0.97
R4993:Bcl3 UTSW 7 19820177 missense probably benign 0.00
R5587:Bcl3 UTSW 7 19809634 nonsense probably null
R6232:Bcl3 UTSW 7 19812484 missense probably damaging 1.00
R7565:Bcl3 UTSW 7 19812494 missense probably damaging 1.00
R8443:Bcl3 UTSW 7 19820157 missense probably benign 0.01
RF022:Bcl3 UTSW 7 19809041 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCTGCTGACCTTAGGTGGC -3'
(R):5'- AAAAGTCCCTTCAGTTCAGTCG -3'

Sequencing Primer
(F):5'- GCCACTCACCCTGGTAGTAAAGG -3'
(R):5'- TTCAGTTCAGTCGGCGGC -3'
Posted On2019-10-07