Mutagenetix > Incidental Mutation

Incidental Mutation 'R7439:Dscaml1'

576825

Institutional Source

Beutler Lab

Gene Symbol

Dscaml1

Ensembl Gene

ENSMUSG00000032087

Gene Name

DS cell adhesion molecule like 1

Synonyms

4921507G06Rik, 4930435C18Rik

MMRRC Submission

045515-MU

Accession Numbers

Genbank: NM_001081270; MGI: 2150309

Essential gene?

Possibly essential (E-score: 0.526) question?

Stock #

R7439 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

45426628-45753712 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 45710326 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1024 (N1024S)

Ref Sequence

ENSEMBL: ENSMUSP00000034592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034592]

AlphaFold

Q4VA61

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034592
AA Change: N1024S

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000034592
Gene: ENSMUSG00000032087
AA Change: N1024S

Domain	Start	End	E-Value	Type
low complexity region	3	17	N/A	INTRINSIC
low complexity region	28	55	N/A	INTRINSIC
IG_like	96	168	1.22e0	SMART
IG	189	277	1.15e-3	SMART
IGc2	296	359	2.54e-14	SMART
IGc2	385	451	8.12e-13	SMART
IGc2	478	550	9.55e-10	SMART
IGc2	575	640	9.78e-7	SMART
IGc2	666	734	5.93e-6	SMART
IGc2	760	832	6.75e-10	SMART
IG	853	943	1e-3	SMART
FN3	945	1029	6.64e-7	SMART
FN3	1045	1133	9.46e-12	SMART
FN3	1148	1234	3.2e-9	SMART
FN3	1249	1332	3.48e-10	SMART
IGc2	1363	1428	1.49e-11	SMART
FN3	1442	1522	3.42e-9	SMART
FN3	1537	1618	2.14e-1	SMART
low complexity region	1671	1683	N/A	INTRINSIC
low complexity region	2018	2026	N/A	INTRINSIC
low complexity region	2035	2069	N/A	INTRINSIC

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ig superfamily of cell adhesion molecules and is involved in neuronal differentiation. The encoded membrane-bound protein localizes to the cell surface, where it forms aggregates that repel neuronal processes of the same cell type. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit impaired self-avoidance in multiple cell types in the retina. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530003J23Rik	G	A	10: 117,238,697		probably benign	Het
Acacb	T	C	5: 114,195,642	V542A	possibly damaging	Het
Adprhl1	C	T	8: 13,223,069	V1230I	probably benign	Het
Agpat1	T	A	17: 34,610,909	Y77N	probably damaging	Het
Apc	T	A	18: 34,312,073	I674K	probably damaging	Het
Arpc5	T	C	1: 152,771,436	S97P	probably damaging	Het
Arrdc5	A	G	17: 56,297,931	F119L	probably benign	Het
Asap1	A	G	15: 64,130,256	V402A	probably damaging	Het
Aspg	T	C	12: 112,124,821	V479A	possibly damaging	Het
B3galnt2	G	A	13: 13,994,485	V368M	probably benign	Het
Bcl3	T	C	7: 19,822,611	T23A	probably benign	Het
Bpifb5	A	G	2: 154,228,933	K215E	possibly damaging	Het
Coa4	T	A	7: 100,539,271	C64S	probably damaging	Het
Dcun1d4	T	C	5: 73,491,536		probably null	Het
Dnaaf5	T	G	5: 139,166,113	C506W	probably damaging	Het
Dock3	A	G	9: 107,023,732	Y345H	probably damaging	Het
Dsp	T	C	13: 38,176,502		probably null	Het
Dsp	A	G	13: 38,195,449	T2057A	probably benign	Het
Dync1h1	T	G	12: 110,636,453	L2176R	probably damaging	Het
Eif5b	A	C	1: 38,051,637	D1192A	probably benign	Het
Epn2	A	T	11: 61,546,848		probably benign	Het
Exoc1	T	A	5: 76,545,348	N360K	probably benign	Het
Fam135b	A	T	15: 71,463,680	V555E	probably damaging	Het
Fam208a	T	A	14: 27,471,645	V934E	probably damaging	Het
Fmn1	A	T	2: 113,441,611	Q108L	unknown	Het
Gcc2	A	G	10: 58,256,901	T48A	probably benign	Het
Gm438	T	C	4: 144,777,762	D273G	probably damaging	Het
Gm6619	T	G	6: 131,490,391	I73S	possibly damaging	Het
Gm8267	T	A	14: 44,722,940	D116V	probably damaging	Het
Hapln3	T	A	7: 79,117,269	T341S	probably benign	Het
Lamb3	C	A	1: 193,332,166	D544E	possibly damaging	Het
Lhx5	T	A	5: 120,440,284	S390T	probably benign	Het
Lrrc63	A	G	14: 75,126,257	S145P	possibly damaging	Het
Lrriq1	T	C	10: 103,214,519	M791V	probably benign	Het
Lyg2	A	G	1: 37,911,137	Y37H	possibly damaging	Het
Nrbp1	T	A	5: 31,244,956	M172K	probably damaging	Het
Olfr1044	T	A	2: 86,171,010	D269V	probably damaging	Het
Olfr1261	A	G	2: 89,993,839	I149V	probably benign	Het
Olfr168	T	G	16: 19,530,900	S7R	probably benign	Het
Pcyt2	A	T	11: 120,611,383	Y308N	possibly damaging	Het
Peg10	C	CTCA	6: 4,756,453		probably benign	Het
Phf21b	A	G	15: 84,804,903	S141P	probably damaging	Het
Pigh	G	A	12: 79,089,550	P24S	probably benign	Het
Plekhg3	A	G	12: 76,576,485	D834G	probably damaging	Het
Plekhg5	T	A	4: 152,113,935	V860D	probably benign	Het
Pon1	A	G	6: 5,177,399	I170T	probably damaging	Het
Ptpn9	T	A	9: 57,027,433	Y160*	probably null	Het
Ptprj	T	C	2: 90,449,819	K1045R	possibly damaging	Het
Rilpl2	T	A	5: 124,463,788	H196L	probably benign	Het
Rnf112	C	T	11: 61,451,028	V317I	possibly damaging	Het
Rundc3a	G	T	11: 102,400,046		probably null	Het
Sgsm1	T	C	5: 113,274,321	Y489C	probably damaging	Het
Sis	G	A	3: 72,909,041	H1531Y	possibly damaging	Het
Slc26a9	A	G	1: 131,762,818	Y520C	probably damaging	Het
Smc5	A	G	19: 23,242,700	V467A	probably damaging	Het
Spata20	G	A	11: 94,484,041	A245V	probably benign	Het
Steap3	A	C	1: 120,241,518	F350V	probably benign	Het
Sucnr1	A	G	3: 60,086,696	Q215R	probably benign	Het
Supv3l1	G	A	10: 62,430,615	A594V	probably damaging	Het
Swt1	A	T	1: 151,411,064	F226I	probably benign	Het
Taar7f	A	G	10: 24,049,987	T160A	possibly damaging	Het
Tada2a	A	T	11: 84,126,986		probably null	Het
Taok3	C	A	5: 117,250,909	Q460K	probably damaging	Het
Twf2	A	G	9: 106,214,398	E268G	probably damaging	Het
Upf2	A	T	2: 6,018,932	I698F	unknown	Het
Vmn2r35	T	A	7: 7,817,014	N86Y	probably damaging	Het
Vmn2r84	T	C	10: 130,392,113	T85A	possibly damaging	Het
Vps13d	A	G	4: 145,105,856	S2833P		Het
Xrn1	T	C	9: 96,051,629	S1584P	probably benign	Het
Zfp354b	T	C	11: 50,922,397	Y567C	probably damaging	Het
Zfp52	A	T	17: 21,560,870	R327*	probably null	Het

Other mutations in Dscaml1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Dscaml1	APN	9	45670200	nonsense	probably null
IGL00497:Dscaml1	APN	9	45752238	missense	probably damaging	1.00
IGL00895:Dscaml1	APN	9	45751253	missense	probably damaging	0.99
IGL01011:Dscaml1	APN	9	45683672	missense	possibly damaging	0.76
IGL01086:Dscaml1	APN	9	45702662	splice site	probably benign
IGL01125:Dscaml1	APN	9	45749632	critical splice acceptor site	probably null
IGL01132:Dscaml1	APN	9	45752328	nonsense	probably null
IGL01356:Dscaml1	APN	9	45746857	missense	probably benign	0.03
IGL01459:Dscaml1	APN	9	45742683	nonsense	probably null
IGL01552:Dscaml1	APN	9	45447908	missense	probably damaging	1.00
IGL02033:Dscaml1	APN	9	45683782	missense	probably damaging	1.00
IGL02044:Dscaml1	APN	9	45746943	nonsense	probably null
IGL02095:Dscaml1	APN	9	45447703	missense	probably damaging	1.00
IGL02166:Dscaml1	APN	9	45683701	missense	probably damaging	0.98
IGL02262:Dscaml1	APN	9	45745116	missense	probably benign
IGL02262:Dscaml1	APN	9	45732080	missense	probably benign	0.44
IGL02340:Dscaml1	APN	9	45670176	missense	possibly damaging	0.66
IGL02604:Dscaml1	APN	9	45744328	unclassified	probably benign
IGL02619:Dscaml1	APN	9	45447796	missense	probably damaging	1.00
IGL02805:Dscaml1	APN	9	45447897	missense	probably damaging	0.98
IGL03409:Dscaml1	APN	9	45670103	missense	probably damaging	1.00
D3080:Dscaml1	UTSW	9	45684325	missense	probably benign	0.44
IGL03050:Dscaml1	UTSW	9	45742999	missense	probably damaging	1.00
R0149:Dscaml1	UTSW	9	45742680	nonsense	probably null
R0582:Dscaml1	UTSW	9	45668264	missense	possibly damaging	0.77
R0629:Dscaml1	UTSW	9	45721418	missense	probably damaging	0.98
R0632:Dscaml1	UTSW	9	45732134	missense	probably benign	0.06
R0815:Dscaml1	UTSW	9	45745074	missense	probably benign	0.00
R1162:Dscaml1	UTSW	9	45752349	splice site	probably benign
R1449:Dscaml1	UTSW	9	45742223	missense	possibly damaging	0.95
R1474:Dscaml1	UTSW	9	45685221	missense	probably damaging	1.00
R1481:Dscaml1	UTSW	9	45672643	missense	probably benign	0.01
R1533:Dscaml1	UTSW	9	45450584	missense	probably damaging	0.99
R1542:Dscaml1	UTSW	9	45749440	missense	possibly damaging	0.84
R1572:Dscaml1	UTSW	9	45721333	missense	probably benign	0.00
R1627:Dscaml1	UTSW	9	45753147	missense	probably damaging	1.00
R1634:Dscaml1	UTSW	9	45672749	missense	probably damaging	1.00
R1713:Dscaml1	UTSW	9	45752690	missense	possibly damaging	0.49
R1777:Dscaml1	UTSW	9	45683756	missense	possibly damaging	0.58
R1812:Dscaml1	UTSW	9	45751286	critical splice donor site	probably null
R1834:Dscaml1	UTSW	9	45683632	missense	probably benign	0.00
R1907:Dscaml1	UTSW	9	45740480	missense	probably damaging	1.00
R1953:Dscaml1	UTSW	9	45670224	missense	probably benign	0.01
R2056:Dscaml1	UTSW	9	45750132	missense	probably damaging	0.99
R2193:Dscaml1	UTSW	9	45685234	missense	probably benign	0.21
R2497:Dscaml1	UTSW	9	45745078	missense	probably benign	0.00
R3768:Dscaml1	UTSW	9	45732137	missense	possibly damaging	0.94
R3891:Dscaml1	UTSW	9	45717484	missense	possibly damaging	0.84
R4110:Dscaml1	UTSW	9	45732068	missense	probably benign	0.07
R4706:Dscaml1	UTSW	9	45450580	missense	probably damaging	1.00
R4716:Dscaml1	UTSW	9	45450592	missense	probably damaging	1.00
R4719:Dscaml1	UTSW	9	45672695	missense	probably benign	0.13
R4770:Dscaml1	UTSW	9	45670106	missense	probably damaging	1.00
R4924:Dscaml1	UTSW	9	45745189	missense	probably damaging	1.00
R5167:Dscaml1	UTSW	9	45717432	missense	probably damaging	1.00
R5346:Dscaml1	UTSW	9	45450559	missense	possibly damaging	0.63
R5737:Dscaml1	UTSW	9	45745185	missense	probably damaging	0.99
R5977:Dscaml1	UTSW	9	45721298	missense	probably benign	0.19
R6073:Dscaml1	UTSW	9	45450583	missense	probably benign	0.22
R6276:Dscaml1	UTSW	9	45668160	missense	possibly damaging	0.62
R6415:Dscaml1	UTSW	9	45683677	nonsense	probably null
R6527:Dscaml1	UTSW	9	45712184	nonsense	probably null
R6582:Dscaml1	UTSW	9	45752806	missense	probably benign	0.00
R6655:Dscaml1	UTSW	9	45746937	missense	probably benign	0.00
R6772:Dscaml1	UTSW	9	45710311	missense	probably damaging	1.00
R6799:Dscaml1	UTSW	9	45450583	missense	probably benign	0.22
R6892:Dscaml1	UTSW	9	45683830	missense	probably damaging	0.99
R6918:Dscaml1	UTSW	9	45430507	missense	probably benign
R6967:Dscaml1	UTSW	9	45674523	missense	probably damaging	0.97
R7214:Dscaml1	UTSW	9	45670139	missense	probably benign	0.01
R7286:Dscaml1	UTSW	9	45742746	critical splice donor site	probably null
R7315:Dscaml1	UTSW	9	45745125	missense	probably benign	0.00
R7338:Dscaml1	UTSW	9	45674504	missense	probably benign	0.12
R7343:Dscaml1	UTSW	9	45752916	missense	probably benign
R7395:Dscaml1	UTSW	9	45702405	missense	possibly damaging	0.73
R7484:Dscaml1	UTSW	9	45749446	splice site	probably null
R7545:Dscaml1	UTSW	9	45685383	missense	probably benign	0.11
R7979:Dscaml1	UTSW	9	45683731	missense	probably damaging	1.00
R8005:Dscaml1	UTSW	9	45717510	missense	probably damaging	1.00
R8181:Dscaml1	UTSW	9	45746842	missense	possibly damaging	0.86
R8262:Dscaml1	UTSW	9	45747140	intron	probably benign
R8428:Dscaml1	UTSW	9	45742586	missense	probably benign	0.00
R8725:Dscaml1	UTSW	9	45430461	missense	probably benign	0.00
R8727:Dscaml1	UTSW	9	45430461	missense	probably benign	0.00
R8796:Dscaml1	UTSW	9	45447728	missense	probably damaging	0.99
R8840:Dscaml1	UTSW	9	45723420	missense	probably damaging	0.99
R9291:Dscaml1	UTSW	9	45447953	missense	probably damaging	1.00
R9394:Dscaml1	UTSW	9	45750056	missense	possibly damaging	0.64
R9610:Dscaml1	UTSW	9	45668224	missense	possibly damaging	0.95
R9611:Dscaml1	UTSW	9	45668224	missense	possibly damaging	0.95
R9653:Dscaml1	UTSW	9	45732168	critical splice donor site	probably null
R9699:Dscaml1	UTSW	9	45743017	missense	probably damaging	0.97
X0058:Dscaml1	UTSW	9	45752128	missense	probably benign	0.00
Z1177:Dscaml1	UTSW	9	45672791	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGGTTGACACTTGAGGCTGG -3'
(R):5'- GTGGCCTCTCTATGACTCATAAAATAC -3'

Sequencing Primer
(F):5'- ACACTTGAGGCTGGGGTAG -3'
(R):5'- TCTGGTTCTCTCTCATTTCTCTCCAG -3'

Posted On

2019-10-07