Incidental Mutation 'R7439:Ptpn9'
ID576826
Institutional Source Beutler Lab
Gene Symbol Ptpn9
Ensembl Gene ENSMUSG00000032290
Gene Nameprotein tyrosine phosphatase, non-receptor type 9
SynonymsMeg2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.617) question?
Stock #R7439 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location56994923-57062807 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 57027433 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 160 (Y160*)
Ref Sequence ENSEMBL: ENSMUSP00000034832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034832] [ENSMUST00000216034]
Predicted Effect probably null
Transcript: ENSMUST00000034832
AA Change: Y160*
SMART Domains Protein: ENSMUSP00000034832
Gene: ENSMUSG00000032290
AA Change: Y160*

DomainStartEndE-ValueType
CRAL_TRIO_N 43 68 1.14e0 SMART
SEC14 90 240 7.33e-40 SMART
PTPc 302 576 1.01e-136 SMART
Predicted Effect probably null
Transcript: ENSMUST00000216034
AA Change: Y83*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal domain that shares a significant similarity with yeast SEC14, which is a protein that has phosphatidylinositol transfer activity and is required for protein secretion through the Golgi complex in yeast. This PTP was found to be activated by polyphosphoinositide, and is thought to be involved in signaling events regulating phagocytosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display hemorrhages, craniofacial anomalies, neural tube defects such as exencephaly and meningomyeloceles, cerebral infarctions, abnormal bone development, and >90% late embryonic lethality in addition to severe defectsin T lymphocyte and platelet activation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530003J23Rik G A 10: 117,238,697 probably benign Het
Acacb T C 5: 114,195,642 V542A possibly damaging Het
Adprhl1 C T 8: 13,223,069 V1230I probably benign Het
Agpat1 T A 17: 34,610,909 Y77N probably damaging Het
Apc T A 18: 34,312,073 I674K probably damaging Het
Arpc5 T C 1: 152,771,436 S97P probably damaging Het
Arrdc5 A G 17: 56,297,931 F119L probably benign Het
Asap1 A G 15: 64,130,256 V402A probably damaging Het
Aspg T C 12: 112,124,821 V479A possibly damaging Het
B3galnt2 G A 13: 13,994,485 V368M probably benign Het
Bcl3 T C 7: 19,822,611 T23A probably benign Het
Bpifb5 A G 2: 154,228,933 K215E possibly damaging Het
Coa4 T A 7: 100,539,271 C64S probably damaging Het
Dcun1d4 T C 5: 73,491,536 probably null Het
Dnaaf5 T G 5: 139,166,113 C506W probably damaging Het
Dock3 A G 9: 107,023,732 Y345H probably damaging Het
Dscaml1 A G 9: 45,710,326 N1024S possibly damaging Het
Dsp T C 13: 38,176,502 probably null Het
Dsp A G 13: 38,195,449 T2057A probably benign Het
Dync1h1 T G 12: 110,636,453 L2176R probably damaging Het
Eif5b A C 1: 38,051,637 D1192A probably benign Het
Epn2 A T 11: 61,546,848 probably benign Het
Exoc1 T A 5: 76,545,348 N360K probably benign Het
Fam135b A T 15: 71,463,680 V555E probably damaging Het
Fam208a T A 14: 27,471,645 V934E probably damaging Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Gcc2 A G 10: 58,256,901 T48A probably benign Het
Gm438 T C 4: 144,777,762 D273G probably damaging Het
Gm6619 T G 6: 131,490,391 I73S possibly damaging Het
Gm8267 T A 14: 44,722,940 D116V probably damaging Het
Hapln3 T A 7: 79,117,269 T341S probably benign Het
Lamb3 C A 1: 193,332,166 D544E possibly damaging Het
Lhx5 T A 5: 120,440,284 S390T probably benign Het
Lrrc63 A G 14: 75,126,257 S145P possibly damaging Het
Lrriq1 T C 10: 103,214,519 M791V probably benign Het
Lyg2 A G 1: 37,911,137 Y37H possibly damaging Het
Nrbp1 T A 5: 31,244,956 M172K probably damaging Het
Olfr1044 T A 2: 86,171,010 D269V probably damaging Het
Olfr1261 A G 2: 89,993,839 I149V probably benign Het
Olfr168 T G 16: 19,530,900 S7R probably benign Het
Pcyt2 A T 11: 120,611,383 Y308N possibly damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Phf21b A G 15: 84,804,903 S141P probably damaging Het
Pigh G A 12: 79,089,550 P24S probably benign Het
Plekhg3 A G 12: 76,576,485 D834G probably damaging Het
Plekhg5 T A 4: 152,113,935 V860D probably benign Het
Pon1 A G 6: 5,177,399 I170T probably damaging Het
Ptprj T C 2: 90,449,819 K1045R possibly damaging Het
Rilpl2 T A 5: 124,463,788 H196L probably benign Het
Rnf112 C T 11: 61,451,028 V317I possibly damaging Het
Rundc3a G T 11: 102,400,046 probably null Het
Sgsm1 T C 5: 113,274,321 Y489C probably damaging Het
Sis G A 3: 72,909,041 H1531Y possibly damaging Het
Slc26a9 A G 1: 131,762,818 Y520C probably damaging Het
Smc5 A G 19: 23,242,700 V467A probably damaging Het
Spata20 G A 11: 94,484,041 A245V probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Sucnr1 A G 3: 60,086,696 Q215R probably benign Het
Supv3l1 G A 10: 62,430,615 A594V probably damaging Het
Swt1 A T 1: 151,411,064 F226I probably benign Het
Taar7f A G 10: 24,049,987 T160A possibly damaging Het
Tada2a A T 11: 84,126,986 probably null Het
Taok3 C A 5: 117,250,909 Q460K probably damaging Het
Twf2 A G 9: 106,214,398 E268G probably damaging Het
Upf2 A T 2: 6,018,932 I698F unknown Het
Vmn2r35 T A 7: 7,817,014 N86Y probably damaging Het
Vmn2r84 T C 10: 130,392,113 T85A possibly damaging Het
Vps13d A G 4: 145,105,856 S2833P Het
Xrn1 T C 9: 96,051,629 S1584P probably benign Het
Zfp354b T C 11: 50,922,397 Y567C probably damaging Het
Zfp52 A T 17: 21,560,870 R327* probably null Het
Other mutations in Ptpn9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Ptpn9 APN 9 57036703 missense possibly damaging 0.68
IGL01388:Ptpn9 APN 9 57036718 missense probably benign 0.00
IGL01953:Ptpn9 APN 9 57056788 missense possibly damaging 0.69
IGL02525:Ptpn9 APN 9 57036725 nonsense probably null
IGL03294:Ptpn9 APN 9 57027387 missense possibly damaging 0.79
BB009:Ptpn9 UTSW 9 57036616 missense possibly damaging 0.48
BB019:Ptpn9 UTSW 9 57036616 missense possibly damaging 0.48
PIT4486001:Ptpn9 UTSW 9 57061003 missense probably damaging 0.99
R0530:Ptpn9 UTSW 9 57061133 missense probably benign
R1617:Ptpn9 UTSW 9 57027408 missense possibly damaging 0.79
R1964:Ptpn9 UTSW 9 57059912 missense probably damaging 1.00
R2426:Ptpn9 UTSW 9 57027428 missense possibly damaging 0.61
R4394:Ptpn9 UTSW 9 57036563 missense possibly damaging 0.91
R4606:Ptpn9 UTSW 9 57022211 missense possibly damaging 0.71
R4658:Ptpn9 UTSW 9 57020037 missense probably benign 0.01
R4660:Ptpn9 UTSW 9 57036498 missense probably benign 0.17
R5141:Ptpn9 UTSW 9 57036676 missense possibly damaging 0.56
R5150:Ptpn9 UTSW 9 57036670 missense probably benign
R5289:Ptpn9 UTSW 9 57060063 critical splice donor site probably null
R5389:Ptpn9 UTSW 9 57056837 intron probably benign
R5422:Ptpn9 UTSW 9 57033157 missense probably damaging 1.00
R5437:Ptpn9 UTSW 9 57020037 missense possibly damaging 0.80
R6075:Ptpn9 UTSW 9 57061146 missense probably benign 0.00
R6084:Ptpn9 UTSW 9 57033163 nonsense probably null
R6481:Ptpn9 UTSW 9 57023040 missense probably damaging 1.00
R7120:Ptpn9 UTSW 9 57059882 missense probably damaging 1.00
R7194:Ptpn9 UTSW 9 57022286 missense probably damaging 1.00
R7195:Ptpn9 UTSW 9 57022249 missense probably benign 0.02
R7349:Ptpn9 UTSW 9 57044376 missense probably benign 0.16
R7441:Ptpn9 UTSW 9 57027433 nonsense probably null
R7801:Ptpn9 UTSW 9 57061013 missense probably benign 0.36
R7879:Ptpn9 UTSW 9 57056726 missense possibly damaging 0.50
R7932:Ptpn9 UTSW 9 57036616 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CTTCCTGTCTAGAAATAGTGCAAAC -3'
(R):5'- GCCATCTCAAATCTTTCAACTTGAC -3'

Sequencing Primer
(F):5'- ACTTCATATCTGACAGGTGAGATGGC -3'
(R):5'- GGTGACCTTTAAAATTGAACAT -3'
Posted On2019-10-07