Incidental Mutation 'R7439:Twf2'
ID 576828
Institutional Source Beutler Lab
Gene Symbol Twf2
Ensembl Gene ENSMUSG00000023277
Gene Name twinfilin actin binding protein 2
Synonyms Ptk9l, Twinfilin-2, A6-related, Twf2
MMRRC Submission 045515-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7439 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 106080307-106092586 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106091597 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 268 (E268G)
Ref Sequence ENSEMBL: ENSMUSP00000024047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024047] [ENSMUST00000187647] [ENSMUST00000187944] [ENSMUST00000188650] [ENSMUST00000216348]
AlphaFold Q9Z0P5
Predicted Effect probably damaging
Transcript: ENSMUST00000024047
AA Change: E268G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024047
Gene: ENSMUSG00000023277
AA Change: E268G

DomainStartEndE-ValueType
ADF 11 139 4.24e-23 SMART
ADF 184 313 1.51e-19 SMART
low complexity region 325 337 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187647
SMART Domains Protein: ENSMUSP00000140617
Gene: ENSMUSG00000023277

DomainStartEndE-ValueType
SCOP:d1f7sa_ 5 34 5e-4 SMART
PDB:2VAC|A 6 44 1e-12 PDB
Blast:ADF 11 48 6e-8 BLAST
low complexity region 56 70 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187944
Predicted Effect probably damaging
Transcript: ENSMUST00000188650
AA Change: E266G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140339
Gene: ENSMUSG00000023277
AA Change: E266G

DomainStartEndE-ValueType
ADF 9 137 4.24e-23 SMART
ADF 182 311 1.51e-19 SMART
low complexity region 323 335 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000216348
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified by its interaction with the catalytic domain of protein kinase C-zeta. The encoded protein contains an actin-binding site and an ATP-binding site. It is most closely related to twinfilin (PTK9), a conserved actin monomer-binding protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele are viable, fertile, and do not display obvious morphological or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Gene trapped(33)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm5 T C 4: 144,504,332 (GRCm39) D273G probably damaging Het
Acacb T C 5: 114,333,703 (GRCm39) V542A possibly damaging Het
Adprhl1 C T 8: 13,273,069 (GRCm39) V1230I probably benign Het
Agpat1 T A 17: 34,829,883 (GRCm39) Y77N probably damaging Het
Apc T A 18: 34,445,126 (GRCm39) I674K probably damaging Het
Arpc5 T C 1: 152,647,187 (GRCm39) S97P probably damaging Het
Arrdc5 A G 17: 56,604,931 (GRCm39) F119L probably benign Het
Asap1 A G 15: 64,002,105 (GRCm39) V402A probably damaging Het
Aspg T C 12: 112,091,255 (GRCm39) V479A possibly damaging Het
B3galnt2 G A 13: 14,169,070 (GRCm39) V368M probably benign Het
Bcl3 T C 7: 19,556,536 (GRCm39) T23A probably benign Het
Bpifb5 A G 2: 154,070,853 (GRCm39) K215E possibly damaging Het
Coa4 T A 7: 100,188,478 (GRCm39) C64S probably damaging Het
Dcun1d4 T C 5: 73,648,879 (GRCm39) probably null Het
Dnaaf5 T G 5: 139,151,868 (GRCm39) C506W probably damaging Het
Dock3 A G 9: 106,900,931 (GRCm39) Y345H probably damaging Het
Dscaml1 A G 9: 45,621,624 (GRCm39) N1024S possibly damaging Het
Dsp T C 13: 38,360,478 (GRCm39) probably null Het
Dsp A G 13: 38,379,425 (GRCm39) T2057A probably benign Het
Dync1h1 T G 12: 110,602,887 (GRCm39) L2176R probably damaging Het
Eif5b A C 1: 38,090,718 (GRCm39) D1192A probably benign Het
Epn2 A T 11: 61,437,674 (GRCm39) probably benign Het
Exoc1 T A 5: 76,693,195 (GRCm39) N360K probably benign Het
Fam135b A T 15: 71,335,529 (GRCm39) V555E probably damaging Het
Fmn1 A T 2: 113,271,956 (GRCm39) Q108L unknown Het
Gcc2 A G 10: 58,092,723 (GRCm39) T48A probably benign Het
Gm6619 T G 6: 131,467,354 (GRCm39) I73S possibly damaging Het
Gm8267 T A 14: 44,960,397 (GRCm39) D116V probably damaging Het
Hapln3 T A 7: 78,767,017 (GRCm39) T341S probably benign Het
Lamb3 C A 1: 193,014,474 (GRCm39) D544E possibly damaging Het
Lhx5 T A 5: 120,578,349 (GRCm39) S390T probably benign Het
Lrrc63 A G 14: 75,363,697 (GRCm39) S145P possibly damaging Het
Lrriq1 T C 10: 103,050,380 (GRCm39) M791V probably benign Het
Lyg2 A G 1: 37,950,218 (GRCm39) Y37H possibly damaging Het
Lyz3 G A 10: 117,074,602 (GRCm39) probably benign Het
Nrbp1 T A 5: 31,402,300 (GRCm39) M172K probably damaging Het
Or2l13b T G 16: 19,349,650 (GRCm39) S7R probably benign Het
Or4c126 A G 2: 89,824,183 (GRCm39) I149V probably benign Het
Or8u9 T A 2: 86,001,354 (GRCm39) D269V probably damaging Het
Pcyt2 A T 11: 120,502,209 (GRCm39) Y308N possibly damaging Het
Peg10 C CTCA 6: 4,756,453 (GRCm39) probably benign Het
Phf21b A G 15: 84,689,104 (GRCm39) S141P probably damaging Het
Pigh G A 12: 79,136,324 (GRCm39) P24S probably benign Het
Plekhg3 A G 12: 76,623,259 (GRCm39) D834G probably damaging Het
Plekhg5 T A 4: 152,198,392 (GRCm39) V860D probably benign Het
Pon1 A G 6: 5,177,399 (GRCm39) I170T probably damaging Het
Ptpn9 T A 9: 56,934,717 (GRCm39) Y160* probably null Het
Ptprj T C 2: 90,280,163 (GRCm39) K1045R possibly damaging Het
Rilpl2 T A 5: 124,601,851 (GRCm39) H196L probably benign Het
Rnf112 C T 11: 61,341,854 (GRCm39) V317I possibly damaging Het
Rundc3a G T 11: 102,290,872 (GRCm39) probably null Het
Sgsm1 T C 5: 113,422,187 (GRCm39) Y489C probably damaging Het
Sis G A 3: 72,816,374 (GRCm39) H1531Y possibly damaging Het
Slc26a9 A G 1: 131,690,556 (GRCm39) Y520C probably damaging Het
Smc5 A G 19: 23,220,064 (GRCm39) V467A probably damaging Het
Spata20 G A 11: 94,374,867 (GRCm39) A245V probably benign Het
Steap3 A C 1: 120,169,248 (GRCm39) F350V probably benign Het
Sucnr1 A G 3: 59,994,117 (GRCm39) Q215R probably benign Het
Supv3l1 G A 10: 62,266,394 (GRCm39) A594V probably damaging Het
Swt1 A T 1: 151,286,815 (GRCm39) F226I probably benign Het
Taar7f A G 10: 23,925,885 (GRCm39) T160A possibly damaging Het
Tada2a A T 11: 84,017,812 (GRCm39) probably null Het
Taok3 C A 5: 117,388,974 (GRCm39) Q460K probably damaging Het
Tasor T A 14: 27,193,602 (GRCm39) V934E probably damaging Het
Upf2 A T 2: 6,023,743 (GRCm39) I698F unknown Het
Vmn2r35 T A 7: 7,820,013 (GRCm39) N86Y probably damaging Het
Vmn2r84 T C 10: 130,227,982 (GRCm39) T85A possibly damaging Het
Vps13d A G 4: 144,832,426 (GRCm39) S2833P Het
Xrn1 T C 9: 95,933,682 (GRCm39) S1584P probably benign Het
Zfp354b T C 11: 50,813,224 (GRCm39) Y567C probably damaging Het
Zfp52 A T 17: 21,781,132 (GRCm39) R327* probably null Het
Other mutations in Twf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Twf2 APN 9 106,090,027 (GRCm39) missense probably benign 0.01
IGL02616:Twf2 APN 9 106,089,955 (GRCm39) nonsense probably null
G5030:Twf2 UTSW 9 106,084,141 (GRCm39) missense possibly damaging 0.66
R0139:Twf2 UTSW 9 106,090,155 (GRCm39) missense possibly damaging 0.69
R1432:Twf2 UTSW 9 106,092,012 (GRCm39) unclassified probably benign
R4579:Twf2 UTSW 9 106,090,025 (GRCm39) missense probably benign 0.20
R4969:Twf2 UTSW 9 106,089,098 (GRCm39) critical splice donor site probably null
R4975:Twf2 UTSW 9 106,089,539 (GRCm39) missense probably damaging 1.00
R5831:Twf2 UTSW 9 106,091,386 (GRCm39) missense probably benign 0.00
R6368:Twf2 UTSW 9 106,090,032 (GRCm39) missense probably benign 0.33
R7026:Twf2 UTSW 9 106,092,079 (GRCm39) missense probably damaging 1.00
R7338:Twf2 UTSW 9 106,081,138 (GRCm39) intron probably benign
R7793:Twf2 UTSW 9 106,089,079 (GRCm39) missense probably damaging 1.00
R8743:Twf2 UTSW 9 106,090,010 (GRCm39) missense possibly damaging 0.77
R9252:Twf2 UTSW 9 106,088,999 (GRCm39) missense probably benign 0.01
R9357:Twf2 UTSW 9 106,092,100 (GRCm39) missense probably benign 0.06
X0024:Twf2 UTSW 9 106,090,168 (GRCm39) missense probably benign
Z1177:Twf2 UTSW 9 106,090,203 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCATACTCATGAGGGTGATGC -3'
(R):5'- CGCAGGATCTACAATGCAGG -3'

Sequencing Primer
(F):5'- CCCTTGAATCTGTGGGTGAGTAGC -3'
(R):5'- AGGATCTACAATGCAGGGTCTGTTAC -3'
Posted On 2019-10-07