Incidental Mutation 'R7439:Dock3'
ID 576829
Institutional Source Beutler Lab
Gene Symbol Dock3
Ensembl Gene ENSMUSG00000039716
Gene Name dedicator of cyto-kinesis 3
Synonyms Moca, PBP
MMRRC Submission 045515-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.549) question?
Stock # R7439 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 106770024-107109108 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106900931 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 345 (Y345H)
Ref Sequence ENSEMBL: ENSMUSP00000047652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044532]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000044532
AA Change: Y345H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047652
Gene: ENSMUSG00000039716
AA Change: Y345H

DomainStartEndE-ValueType
SH3 9 66 3.85e-9 SMART
Pfam:DOCK_N 69 412 1.4e-120 PFAM
Pfam:DOCK-C2 417 608 7.7e-56 PFAM
low complexity region 854 867 N/A INTRINSIC
low complexity region 892 916 N/A INTRINSIC
Pfam:DHR-2 1121 1628 9e-133 PFAM
low complexity region 1679 1690 N/A INTRINSIC
low complexity region 1693 1704 N/A INTRINSIC
low complexity region 1730 1754 N/A INTRINSIC
low complexity region 1880 1902 N/A INTRINSIC
low complexity region 1963 1977 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is specifically expressed in the central nervous system (CNS). It encodes a member of the DOCK (dedicator of cytokinesis) family of guanine nucleotide exchange factors (GEFs). This protein, dedicator of cytokinesis 3 (DOCK3), is also known as modifier of cell adhesion (MOCA) and presenilin-binding protein (PBP). The DOCK3 and DOCK1, -2 and -4 share several conserved amino acids in their DHR-2 (DOCK homology region 2) domains that are required for GEF activity, and bind directly to WAVE proteins [Wiskott-Aldrich syndrome protein (WASP) family Verprolin-homologous proteins] via their DHR-1 domains. The DOCK3 induces axonal outgrowth in CNS by stimulating membrane recruitment of the WAVE complex and activating the small G protein Rac1. This gene is associated with an attention deficit hyperactivity disorder-like phenotype by a complex chromosomal rearrangement. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal behaviors and muscular weakness associated with axonal dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm5 T C 4: 144,504,332 (GRCm39) D273G probably damaging Het
Acacb T C 5: 114,333,703 (GRCm39) V542A possibly damaging Het
Adprhl1 C T 8: 13,273,069 (GRCm39) V1230I probably benign Het
Agpat1 T A 17: 34,829,883 (GRCm39) Y77N probably damaging Het
Apc T A 18: 34,445,126 (GRCm39) I674K probably damaging Het
Arpc5 T C 1: 152,647,187 (GRCm39) S97P probably damaging Het
Arrdc5 A G 17: 56,604,931 (GRCm39) F119L probably benign Het
Asap1 A G 15: 64,002,105 (GRCm39) V402A probably damaging Het
Aspg T C 12: 112,091,255 (GRCm39) V479A possibly damaging Het
B3galnt2 G A 13: 14,169,070 (GRCm39) V368M probably benign Het
Bcl3 T C 7: 19,556,536 (GRCm39) T23A probably benign Het
Bpifb5 A G 2: 154,070,853 (GRCm39) K215E possibly damaging Het
Coa4 T A 7: 100,188,478 (GRCm39) C64S probably damaging Het
Dcun1d4 T C 5: 73,648,879 (GRCm39) probably null Het
Dnaaf5 T G 5: 139,151,868 (GRCm39) C506W probably damaging Het
Dscaml1 A G 9: 45,621,624 (GRCm39) N1024S possibly damaging Het
Dsp T C 13: 38,360,478 (GRCm39) probably null Het
Dsp A G 13: 38,379,425 (GRCm39) T2057A probably benign Het
Dync1h1 T G 12: 110,602,887 (GRCm39) L2176R probably damaging Het
Eif5b A C 1: 38,090,718 (GRCm39) D1192A probably benign Het
Epn2 A T 11: 61,437,674 (GRCm39) probably benign Het
Exoc1 T A 5: 76,693,195 (GRCm39) N360K probably benign Het
Fam135b A T 15: 71,335,529 (GRCm39) V555E probably damaging Het
Fmn1 A T 2: 113,271,956 (GRCm39) Q108L unknown Het
Gcc2 A G 10: 58,092,723 (GRCm39) T48A probably benign Het
Gm6619 T G 6: 131,467,354 (GRCm39) I73S possibly damaging Het
Gm8267 T A 14: 44,960,397 (GRCm39) D116V probably damaging Het
Hapln3 T A 7: 78,767,017 (GRCm39) T341S probably benign Het
Lamb3 C A 1: 193,014,474 (GRCm39) D544E possibly damaging Het
Lhx5 T A 5: 120,578,349 (GRCm39) S390T probably benign Het
Lrrc63 A G 14: 75,363,697 (GRCm39) S145P possibly damaging Het
Lrriq1 T C 10: 103,050,380 (GRCm39) M791V probably benign Het
Lyg2 A G 1: 37,950,218 (GRCm39) Y37H possibly damaging Het
Lyz3 G A 10: 117,074,602 (GRCm39) probably benign Het
Nrbp1 T A 5: 31,402,300 (GRCm39) M172K probably damaging Het
Or2l13b T G 16: 19,349,650 (GRCm39) S7R probably benign Het
Or4c126 A G 2: 89,824,183 (GRCm39) I149V probably benign Het
Or8u9 T A 2: 86,001,354 (GRCm39) D269V probably damaging Het
Pcyt2 A T 11: 120,502,209 (GRCm39) Y308N possibly damaging Het
Peg10 C CTCA 6: 4,756,453 (GRCm39) probably benign Het
Phf21b A G 15: 84,689,104 (GRCm39) S141P probably damaging Het
Pigh G A 12: 79,136,324 (GRCm39) P24S probably benign Het
Plekhg3 A G 12: 76,623,259 (GRCm39) D834G probably damaging Het
Plekhg5 T A 4: 152,198,392 (GRCm39) V860D probably benign Het
Pon1 A G 6: 5,177,399 (GRCm39) I170T probably damaging Het
Ptpn9 T A 9: 56,934,717 (GRCm39) Y160* probably null Het
Ptprj T C 2: 90,280,163 (GRCm39) K1045R possibly damaging Het
Rilpl2 T A 5: 124,601,851 (GRCm39) H196L probably benign Het
Rnf112 C T 11: 61,341,854 (GRCm39) V317I possibly damaging Het
Rundc3a G T 11: 102,290,872 (GRCm39) probably null Het
Sgsm1 T C 5: 113,422,187 (GRCm39) Y489C probably damaging Het
Sis G A 3: 72,816,374 (GRCm39) H1531Y possibly damaging Het
Slc26a9 A G 1: 131,690,556 (GRCm39) Y520C probably damaging Het
Smc5 A G 19: 23,220,064 (GRCm39) V467A probably damaging Het
Spata20 G A 11: 94,374,867 (GRCm39) A245V probably benign Het
Steap3 A C 1: 120,169,248 (GRCm39) F350V probably benign Het
Sucnr1 A G 3: 59,994,117 (GRCm39) Q215R probably benign Het
Supv3l1 G A 10: 62,266,394 (GRCm39) A594V probably damaging Het
Swt1 A T 1: 151,286,815 (GRCm39) F226I probably benign Het
Taar7f A G 10: 23,925,885 (GRCm39) T160A possibly damaging Het
Tada2a A T 11: 84,017,812 (GRCm39) probably null Het
Taok3 C A 5: 117,388,974 (GRCm39) Q460K probably damaging Het
Tasor T A 14: 27,193,602 (GRCm39) V934E probably damaging Het
Twf2 A G 9: 106,091,597 (GRCm39) E268G probably damaging Het
Upf2 A T 2: 6,023,743 (GRCm39) I698F unknown Het
Vmn2r35 T A 7: 7,820,013 (GRCm39) N86Y probably damaging Het
Vmn2r84 T C 10: 130,227,982 (GRCm39) T85A possibly damaging Het
Vps13d A G 4: 144,832,426 (GRCm39) S2833P Het
Xrn1 T C 9: 95,933,682 (GRCm39) S1584P probably benign Het
Zfp354b T C 11: 50,813,224 (GRCm39) Y567C probably damaging Het
Zfp52 A T 17: 21,781,132 (GRCm39) R327* probably null Het
Other mutations in Dock3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Dock3 APN 9 106,788,576 (GRCm39) splice site probably benign
IGL01067:Dock3 APN 9 106,959,572 (GRCm39) critical splice donor site probably null
IGL01160:Dock3 APN 9 106,783,887 (GRCm39) missense probably damaging 1.00
IGL01290:Dock3 APN 9 106,835,599 (GRCm39) splice site probably benign
IGL01291:Dock3 APN 9 106,835,599 (GRCm39) splice site probably benign
IGL01391:Dock3 APN 9 106,784,433 (GRCm39) missense possibly damaging 0.55
IGL01399:Dock3 APN 9 106,870,670 (GRCm39) missense probably benign 0.06
IGL01660:Dock3 APN 9 106,909,563 (GRCm39) splice site probably benign
IGL01752:Dock3 APN 9 106,902,512 (GRCm39) splice site probably benign
IGL01820:Dock3 APN 9 106,773,092 (GRCm39) missense probably damaging 1.00
IGL01908:Dock3 APN 9 106,783,861 (GRCm39) missense possibly damaging 0.81
IGL02191:Dock3 APN 9 106,815,340 (GRCm39) missense probably benign
IGL02227:Dock3 APN 9 106,939,254 (GRCm39) missense probably damaging 0.98
IGL02309:Dock3 APN 9 106,790,351 (GRCm39) missense probably damaging 1.00
IGL02408:Dock3 APN 9 106,790,298 (GRCm39) splice site probably benign
IGL02469:Dock3 APN 9 106,863,215 (GRCm39) missense probably damaging 0.98
IGL02545:Dock3 APN 9 106,939,271 (GRCm39) missense probably damaging 1.00
IGL02894:Dock3 APN 9 106,807,298 (GRCm39) missense probably benign 0.00
IGL02934:Dock3 APN 9 106,900,944 (GRCm39) missense probably benign 0.01
IGL03027:Dock3 APN 9 106,870,677 (GRCm39) missense probably damaging 0.98
IGL03068:Dock3 APN 9 106,841,958 (GRCm39) missense possibly damaging 0.82
IGL03128:Dock3 APN 9 106,909,491 (GRCm39) missense probably benign 0.05
IGL03161:Dock3 APN 9 106,900,987 (GRCm39) missense probably damaging 0.99
IGL03263:Dock3 APN 9 106,807,330 (GRCm39) splice site probably benign
IGL03279:Dock3 APN 9 106,788,447 (GRCm39) splice site probably benign
IGL03366:Dock3 APN 9 106,882,632 (GRCm39) missense probably benign 0.01
Implosion UTSW 9 106,815,125 (GRCm39) missense probably benign 0.00
Squeeze UTSW 9 106,807,242 (GRCm39) missense probably damaging 1.00
Tight UTSW 9 106,872,080 (GRCm39) missense probably damaging 1.00
ANU05:Dock3 UTSW 9 106,772,862 (GRCm39) missense probably benign
R0025:Dock3 UTSW 9 106,790,467 (GRCm39) missense possibly damaging 0.90
R0025:Dock3 UTSW 9 106,790,467 (GRCm39) missense possibly damaging 0.90
R0030:Dock3 UTSW 9 106,789,512 (GRCm39) missense possibly damaging 0.64
R0076:Dock3 UTSW 9 106,788,685 (GRCm39) splice site probably benign
R0076:Dock3 UTSW 9 106,788,685 (GRCm39) splice site probably benign
R0206:Dock3 UTSW 9 106,874,195 (GRCm39) nonsense probably null
R0208:Dock3 UTSW 9 106,874,195 (GRCm39) nonsense probably null
R0384:Dock3 UTSW 9 106,779,094 (GRCm39) splice site probably benign
R0610:Dock3 UTSW 9 106,900,987 (GRCm39) missense probably damaging 0.99
R0731:Dock3 UTSW 9 106,847,055 (GRCm39) missense probably damaging 1.00
R1184:Dock3 UTSW 9 106,846,999 (GRCm39) missense probably damaging 1.00
R1350:Dock3 UTSW 9 106,791,831 (GRCm39) missense possibly damaging 0.52
R1393:Dock3 UTSW 9 106,788,548 (GRCm39) missense probably damaging 1.00
R1424:Dock3 UTSW 9 106,790,392 (GRCm39) missense probably damaging 1.00
R1469:Dock3 UTSW 9 106,832,908 (GRCm39) missense probably benign 0.37
R1469:Dock3 UTSW 9 106,832,908 (GRCm39) missense probably benign 0.37
R1539:Dock3 UTSW 9 106,874,112 (GRCm39) missense probably benign 0.23
R1539:Dock3 UTSW 9 106,829,563 (GRCm39) missense probably damaging 1.00
R1571:Dock3 UTSW 9 106,815,158 (GRCm39) missense possibly damaging 0.92
R1682:Dock3 UTSW 9 106,851,040 (GRCm39) missense probably damaging 0.98
R1795:Dock3 UTSW 9 106,902,534 (GRCm39) missense probably damaging 0.99
R1987:Dock3 UTSW 9 106,985,620 (GRCm39) missense probably benign 0.01
R2000:Dock3 UTSW 9 106,870,160 (GRCm39) splice site probably benign
R2074:Dock3 UTSW 9 106,870,662 (GRCm39) missense possibly damaging 0.46
R2114:Dock3 UTSW 9 106,870,743 (GRCm39) missense probably benign 0.00
R2265:Dock3 UTSW 9 106,818,525 (GRCm39) missense probably damaging 1.00
R2269:Dock3 UTSW 9 106,818,525 (GRCm39) missense probably damaging 1.00
R2370:Dock3 UTSW 9 106,829,554 (GRCm39) missense probably damaging 1.00
R2377:Dock3 UTSW 9 106,773,090 (GRCm39) missense probably damaging 0.98
R2385:Dock3 UTSW 9 106,868,324 (GRCm39) missense probably damaging 1.00
R2426:Dock3 UTSW 9 106,791,740 (GRCm39) missense possibly damaging 0.76
R3076:Dock3 UTSW 9 106,818,725 (GRCm39) critical splice acceptor site probably null
R3122:Dock3 UTSW 9 106,788,542 (GRCm39) missense probably damaging 0.99
R4052:Dock3 UTSW 9 106,850,995 (GRCm39) missense probably damaging 0.99
R4294:Dock3 UTSW 9 106,807,242 (GRCm39) missense probably damaging 1.00
R4623:Dock3 UTSW 9 106,939,244 (GRCm39) missense possibly damaging 0.61
R4664:Dock3 UTSW 9 106,870,743 (GRCm39) missense possibly damaging 0.71
R4705:Dock3 UTSW 9 106,902,535 (GRCm39) missense probably damaging 1.00
R4771:Dock3 UTSW 9 106,829,557 (GRCm39) missense possibly damaging 0.89
R4898:Dock3 UTSW 9 106,870,171 (GRCm39) missense possibly damaging 0.75
R4898:Dock3 UTSW 9 106,807,266 (GRCm39) missense probably damaging 1.00
R4948:Dock3 UTSW 9 106,868,354 (GRCm39) missense probably damaging 0.96
R4961:Dock3 UTSW 9 106,818,515 (GRCm39) missense probably damaging 1.00
R4986:Dock3 UTSW 9 106,809,182 (GRCm39) missense probably damaging 1.00
R5054:Dock3 UTSW 9 106,815,105 (GRCm39) missense probably damaging 1.00
R5065:Dock3 UTSW 9 106,832,883 (GRCm39) missense probably damaging 1.00
R5081:Dock3 UTSW 9 106,868,292 (GRCm39) missense probably damaging 1.00
R5101:Dock3 UTSW 9 106,846,980 (GRCm39) missense probably damaging 1.00
R5135:Dock3 UTSW 9 106,810,196 (GRCm39) missense probably damaging 1.00
R5227:Dock3 UTSW 9 106,863,269 (GRCm39) missense probably damaging 1.00
R5257:Dock3 UTSW 9 106,874,124 (GRCm39) missense probably damaging 1.00
R5258:Dock3 UTSW 9 106,874,124 (GRCm39) missense probably damaging 1.00
R5273:Dock3 UTSW 9 106,777,904 (GRCm39) critical splice donor site probably null
R5322:Dock3 UTSW 9 106,779,028 (GRCm39) missense probably benign 0.14
R5482:Dock3 UTSW 9 106,855,937 (GRCm39) nonsense probably null
R5553:Dock3 UTSW 9 106,868,309 (GRCm39) missense possibly damaging 0.81
R5631:Dock3 UTSW 9 106,832,898 (GRCm39) missense probably benign 0.01
R5739:Dock3 UTSW 9 106,850,995 (GRCm39) missense possibly damaging 0.92
R5838:Dock3 UTSW 9 106,772,687 (GRCm39) missense possibly damaging 0.51
R5888:Dock3 UTSW 9 106,901,002 (GRCm39) missense probably benign 0.12
R5960:Dock3 UTSW 9 106,788,554 (GRCm39) nonsense probably null
R5974:Dock3 UTSW 9 106,871,261 (GRCm39) missense probably damaging 1.00
R6116:Dock3 UTSW 9 106,809,161 (GRCm39) missense probably damaging 1.00
R6162:Dock3 UTSW 9 106,841,998 (GRCm39) missense possibly damaging 0.88
R6176:Dock3 UTSW 9 106,790,147 (GRCm39) missense probably benign 0.05
R6219:Dock3 UTSW 9 106,872,080 (GRCm39) missense probably damaging 1.00
R6238:Dock3 UTSW 9 106,790,147 (GRCm39) missense probably benign 0.05
R6266:Dock3 UTSW 9 106,841,952 (GRCm39) missense probably damaging 0.99
R6291:Dock3 UTSW 9 106,785,631 (GRCm39) missense probably benign
R6531:Dock3 UTSW 9 106,844,415 (GRCm39) missense probably benign
R6567:Dock3 UTSW 9 106,773,946 (GRCm39) missense probably benign 0.13
R6572:Dock3 UTSW 9 106,866,674 (GRCm39) missense probably damaging 0.99
R6620:Dock3 UTSW 9 106,815,125 (GRCm39) missense probably benign 0.00
R6726:Dock3 UTSW 9 107,036,651 (GRCm39) nonsense probably null
R7085:Dock3 UTSW 9 106,779,086 (GRCm39) missense probably damaging 1.00
R7151:Dock3 UTSW 9 106,841,916 (GRCm39) missense possibly damaging 0.68
R7320:Dock3 UTSW 9 106,772,723 (GRCm39) missense probably benign 0.20
R7357:Dock3 UTSW 9 106,882,568 (GRCm39) missense probably benign 0.34
R7423:Dock3 UTSW 9 106,844,370 (GRCm39) missense probably damaging 0.98
R7426:Dock3 UTSW 9 106,772,782 (GRCm39) missense probably benign
R7452:Dock3 UTSW 9 106,866,664 (GRCm39) missense probably damaging 1.00
R7470:Dock3 UTSW 9 106,882,644 (GRCm39) missense probably damaging 1.00
R7879:Dock3 UTSW 9 106,785,700 (GRCm39) missense probably benign 0.05
R8047:Dock3 UTSW 9 106,870,208 (GRCm39) missense possibly damaging 0.93
R8308:Dock3 UTSW 9 106,790,371 (GRCm39) missense probably benign 0.00
R8837:Dock3 UTSW 9 106,774,539 (GRCm39) missense probably benign
R8862:Dock3 UTSW 9 106,855,927 (GRCm39) missense probably damaging 1.00
R8952:Dock3 UTSW 9 106,850,958 (GRCm39) missense probably benign 0.03
R9230:Dock3 UTSW 9 106,807,223 (GRCm39) missense probably damaging 1.00
R9269:Dock3 UTSW 9 106,818,522 (GRCm39) missense probably benign 0.01
R9272:Dock3 UTSW 9 106,774,569 (GRCm39) missense probably benign 0.00
R9344:Dock3 UTSW 9 106,870,763 (GRCm39) missense probably damaging 1.00
R9757:Dock3 UTSW 9 106,901,035 (GRCm39) missense possibly damaging 0.48
R9764:Dock3 UTSW 9 106,959,713 (GRCm39) missense probably benign 0.00
R9766:Dock3 UTSW 9 106,788,483 (GRCm39) missense probably benign 0.01
X0023:Dock3 UTSW 9 106,863,197 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GAAATGGGTACTATCAGACTTTCAC -3'
(R):5'- AAGGAGCCTGAATTCTCTGTGTAATTG -3'

Sequencing Primer
(F):5'- TGGGTACTATCAGACTTTCACTTTAG -3'
(R):5'- AATTGTTGCTTTCTGCTGTGCCTAAG -3'
Posted On 2019-10-07