Mutagenetix > Incidental Mutation

Incidental Mutation 'R7439:Supv3l1'

576832

Institutional Source

Beutler Lab

Gene Symbol

Supv3l1

Ensembl Gene

ENSMUSG00000020079

Gene Name

suppressor of var1, 3-like 1 (S. cerevisiae)

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7439 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

62429209-62449738 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 62430615 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 594 (A594V)

Ref Sequence

ENSEMBL: ENSMUSP00000020273 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020273]

AlphaFold

Q80YD1

Predicted Effect

probably damaging
Transcript: ENSMUST00000020273
AA Change: A594V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000020273
Gene: ENSMUSG00000020079
AA Change: A594V

Domain	Start	End	E-Value	Type
low complexity region	8	25	N/A	INTRINSIC
low complexity region	47	56	N/A	INTRINSIC
HELICc	379	475	1.44e-18	SMART
Pfam:SUV3_C	625	672	4e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000162023

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit embryonic lethality between E9.5 and E12.5. Mice homozygous for a knock-out allele exhibit embryonic lethality between E8.5 and 9.5. Mice heterozygous for this allele produce offspring with mitochondrial defects regardless of offspring genotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530003J23Rik	G	A	10: 117,238,697		probably benign	Het
Acacb	T	C	5: 114,195,642	V542A	possibly damaging	Het
Adprhl1	C	T	8: 13,223,069	V1230I	probably benign	Het
Agpat1	T	A	17: 34,610,909	Y77N	probably damaging	Het
Apc	T	A	18: 34,312,073	I674K	probably damaging	Het
Arpc5	T	C	1: 152,771,436	S97P	probably damaging	Het
Arrdc5	A	G	17: 56,297,931	F119L	probably benign	Het
Asap1	A	G	15: 64,130,256	V402A	probably damaging	Het
Aspg	T	C	12: 112,124,821	V479A	possibly damaging	Het
B3galnt2	G	A	13: 13,994,485	V368M	probably benign	Het
Bcl3	T	C	7: 19,822,611	T23A	probably benign	Het
Bpifb5	A	G	2: 154,228,933	K215E	possibly damaging	Het
Coa4	T	A	7: 100,539,271	C64S	probably damaging	Het
Dcun1d4	T	C	5: 73,491,536		probably null	Het
Dnaaf5	T	G	5: 139,166,113	C506W	probably damaging	Het
Dock3	A	G	9: 107,023,732	Y345H	probably damaging	Het
Dscaml1	A	G	9: 45,710,326	N1024S	possibly damaging	Het
Dsp	T	C	13: 38,176,502		probably null	Het
Dsp	A	G	13: 38,195,449	T2057A	probably benign	Het
Dync1h1	T	G	12: 110,636,453	L2176R	probably damaging	Het
Eif5b	A	C	1: 38,051,637	D1192A	probably benign	Het
Epn2	A	T	11: 61,546,848		probably benign	Het
Exoc1	T	A	5: 76,545,348	N360K	probably benign	Het
Fam135b	A	T	15: 71,463,680	V555E	probably damaging	Het
Fam208a	T	A	14: 27,471,645	V934E	probably damaging	Het
Fmn1	A	T	2: 113,441,611	Q108L	unknown	Het
Gcc2	A	G	10: 58,256,901	T48A	probably benign	Het
Gm438	T	C	4: 144,777,762	D273G	probably damaging	Het
Gm6619	T	G	6: 131,490,391	I73S	possibly damaging	Het
Gm8267	T	A	14: 44,722,940	D116V	probably damaging	Het
Hapln3	T	A	7: 79,117,269	T341S	probably benign	Het
Lamb3	C	A	1: 193,332,166	D544E	possibly damaging	Het
Lhx5	T	A	5: 120,440,284	S390T	probably benign	Het
Lrrc63	A	G	14: 75,126,257	S145P	possibly damaging	Het
Lrriq1	T	C	10: 103,214,519	M791V	probably benign	Het
Lyg2	A	G	1: 37,911,137	Y37H	possibly damaging	Het
Nrbp1	T	A	5: 31,244,956	M172K	probably damaging	Het
Olfr1044	T	A	2: 86,171,010	D269V	probably damaging	Het
Olfr1261	A	G	2: 89,993,839	I149V	probably benign	Het
Olfr168	T	G	16: 19,530,900	S7R	probably benign	Het
Pcyt2	A	T	11: 120,611,383	Y308N	possibly damaging	Het
Peg10	C	CTCA	6: 4,756,453		probably benign	Het
Phf21b	A	G	15: 84,804,903	S141P	probably damaging	Het
Pigh	G	A	12: 79,089,550	P24S	probably benign	Het
Plekhg3	A	G	12: 76,576,485	D834G	probably damaging	Het
Plekhg5	T	A	4: 152,113,935	V860D	probably benign	Het
Pon1	A	G	6: 5,177,399	I170T	probably damaging	Het
Ptpn9	T	A	9: 57,027,433	Y160*	probably null	Het
Ptprj	T	C	2: 90,449,819	K1045R	possibly damaging	Het
Rilpl2	T	A	5: 124,463,788	H196L	probably benign	Het
Rnf112	C	T	11: 61,451,028	V317I	possibly damaging	Het
Rundc3a	G	T	11: 102,400,046		probably null	Het
Sgsm1	T	C	5: 113,274,321	Y489C	probably damaging	Het
Sis	G	A	3: 72,909,041	H1531Y	possibly damaging	Het
Slc26a9	A	G	1: 131,762,818	Y520C	probably damaging	Het
Smc5	A	G	19: 23,242,700	V467A	probably damaging	Het
Spata20	G	A	11: 94,484,041	A245V	probably benign	Het
Steap3	A	C	1: 120,241,518	F350V	probably benign	Het
Sucnr1	A	G	3: 60,086,696	Q215R	probably benign	Het
Swt1	A	T	1: 151,411,064	F226I	probably benign	Het
Taar7f	A	G	10: 24,049,987	T160A	possibly damaging	Het
Tada2a	A	T	11: 84,126,986		probably null	Het
Taok3	C	A	5: 117,250,909	Q460K	probably damaging	Het
Twf2	A	G	9: 106,214,398	E268G	probably damaging	Het
Upf2	A	T	2: 6,018,932	I698F	unknown	Het
Vmn2r35	T	A	7: 7,817,014	N86Y	probably damaging	Het
Vmn2r84	T	C	10: 130,392,113	T85A	possibly damaging	Het
Vps13d	A	G	4: 145,105,856	S2833P		Het
Xrn1	T	C	9: 96,051,629	S1584P	probably benign	Het
Zfp354b	T	C	11: 50,922,397	Y567C	probably damaging	Het
Zfp52	A	T	17: 21,560,870	R327*	probably null	Het

Other mutations in Supv3l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03067:Supv3l1	APN	10	62429821	missense	probably damaging	1.00
R0090:Supv3l1	UTSW	10	62429706	missense	probably benign	0.00
R0477:Supv3l1	UTSW	10	62430585	missense	probably damaging	0.98
R0946:Supv3l1	UTSW	10	62429820	missense	probably damaging	1.00
R1460:Supv3l1	UTSW	10	62443383	splice site	probably benign
R1546:Supv3l1	UTSW	10	62432446	missense	probably benign	0.08
R1941:Supv3l1	UTSW	10	62449612	missense	probably benign
R3916:Supv3l1	UTSW	10	62449420	missense	possibly damaging	0.67
R5030:Supv3l1	UTSW	10	62430615	missense	probably damaging	1.00
R5040:Supv3l1	UTSW	10	62447065	missense	possibly damaging	0.93
R5051:Supv3l1	UTSW	10	62443417	missense	probably damaging	0.99
R5085:Supv3l1	UTSW	10	62435512	missense	probably benign	0.00
R5288:Supv3l1	UTSW	10	62430596	missense	possibly damaging	0.90
R5359:Supv3l1	UTSW	10	62432399	missense	probably damaging	0.96
R5372:Supv3l1	UTSW	10	62432357	missense	probably damaging	0.99
R5384:Supv3l1	UTSW	10	62430596	missense	possibly damaging	0.90
R5385:Supv3l1	UTSW	10	62430596	missense	possibly damaging	0.90
R5527:Supv3l1	UTSW	10	62429829	missense	probably damaging	1.00
R5602:Supv3l1	UTSW	10	62430592	missense	possibly damaging	0.81
R5713:Supv3l1	UTSW	10	62430504	missense	possibly damaging	0.91
R6150:Supv3l1	UTSW	10	62435722	missense	possibly damaging	0.90
R6220:Supv3l1	UTSW	10	62439021	missense	possibly damaging	0.82
R6903:Supv3l1	UTSW	10	62441237	missense	probably damaging	1.00
R6941:Supv3l1	UTSW	10	62430586	missense	possibly damaging	0.86
R7187:Supv3l1	UTSW	10	62435549	missense	probably damaging	1.00
R7250:Supv3l1	UTSW	10	62445067	missense	probably damaging	1.00
R7438:Supv3l1	UTSW	10	62430470	critical splice donor site	probably null
R7515:Supv3l1	UTSW	10	62432311	missense	probably damaging	1.00
R7579:Supv3l1	UTSW	10	62435708	missense	probably damaging	1.00
R7579:Supv3l1	UTSW	10	62435709	missense	possibly damaging	0.61
R7923:Supv3l1	UTSW	10	62445081	missense	probably damaging	0.98
R7973:Supv3l1	UTSW	10	62449423	missense	probably damaging	1.00
R8098:Supv3l1	UTSW	10	62429503	missense	probably benign	0.01
R8327:Supv3l1	UTSW	10	62441225	missense	probably damaging	1.00
R8699:Supv3l1	UTSW	10	62432455	missense	possibly damaging	0.95
R8947:Supv3l1	UTSW	10	62432339	missense	probably benign	0.28
R9169:Supv3l1	UTSW	10	62432459	missense	probably damaging	1.00
R9509:Supv3l1	UTSW	10	62429632	missense	probably benign
R9520:Supv3l1	UTSW	10	62432402	missense	probably damaging	1.00
RF016:Supv3l1	UTSW	10	62437508	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- GGAGCAGAAGCCCACTCAC -3'
(R):5'- CCCCAGTTTAATTTCAAACAAACATT -3'

Sequencing Primer
(F):5'- TGCCCTGAGTTAGAAAATTGTGAGC -3'
(R):5'- AGTCAGGAATTCAAGGCCTCTCTTG -3'

Posted On

2019-10-07