Incidental Mutation 'R7439:Epn2'
ID576838
Institutional Source Beutler Lab
Gene Symbol Epn2
Ensembl Gene ENSMUSG00000001036
Gene Nameepsin 2
SynonymsIbp2, 9530051D10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7439 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location61517249-61579687 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) A to T at 61546848 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001063] [ENSMUST00000108711] [ENSMUST00000108712] [ENSMUST00000108713] [ENSMUST00000146455] [ENSMUST00000147501] [ENSMUST00000178202] [ENSMUST00000179936]
Predicted Effect probably benign
Transcript: ENSMUST00000001063
SMART Domains Protein: ENSMUSP00000001063
Gene: ENSMUSG00000001036

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 218 237 3.37e-1 SMART
UIM 255 274 2.48e1 SMART
low complexity region 449 461 N/A INTRINSIC
low complexity region 493 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108711
SMART Domains Protein: ENSMUSP00000104351
Gene: ENSMUSG00000001036

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 218 237 6.29e-1 SMART
UIM 243 262 2.48e1 SMART
low complexity region 431 443 N/A INTRINSIC
low complexity region 475 499 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108712
SMART Domains Protein: ENSMUSP00000104352
Gene: ENSMUSG00000001036

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 275 294 6.29e-1 SMART
UIM 300 319 2.48e1 SMART
low complexity region 488 500 N/A INTRINSIC
low complexity region 532 556 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108713
SMART Domains Protein: ENSMUSP00000104353
Gene: ENSMUSG00000001036

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 218 237 6.29e-1 SMART
UIM 243 262 2.48e1 SMART
low complexity region 437 449 N/A INTRINSIC
low complexity region 481 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146455
Predicted Effect probably benign
Transcript: ENSMUST00000147501
SMART Domains Protein: ENSMUSP00000117389
Gene: ENSMUSG00000001036

DomainStartEndE-ValueType
Pfam:ENTH 17 80 2.1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148956
SMART Domains Protein: ENSMUSP00000122514
Gene: ENSMUSG00000001036

DomainStartEndE-ValueType
SCOP:d1eyha_ 2 35 1e-9 SMART
PDB:1EDU|A 2 37 5e-8 PDB
UIM 152 171 6.29e-1 SMART
UIM 177 196 2.48e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153984
SMART Domains Protein: ENSMUSP00000122666
Gene: ENSMUSG00000001036

DomainStartEndE-ValueType
UIM 72 91 3.37e-1 SMART
UIM 109 128 2.48e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178202
SMART Domains Protein: ENSMUSP00000136553
Gene: ENSMUSG00000001036

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 218 237 3.37e-1 SMART
UIM 255 274 2.48e1 SMART
low complexity region 449 461 N/A INTRINSIC
low complexity region 493 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179936
SMART Domains Protein: ENSMUSP00000136950
Gene: ENSMUSG00000001036

DomainStartEndE-ValueType
ENTH 18 144 1.03e-65 SMART
UIM 275 294 6.29e-1 SMART
UIM 300 319 2.48e1 SMART
low complexity region 494 506 N/A INTRINSIC
low complexity region 538 562 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which interacts with clathrin and adaptor-related protein complex 2, alpha 1 subunit. The protein is found in a brain-derived clathrin-coated vesicle fraction and localizes to the peri-Golgi region and the cell periphery. The protein is thought to be involved in clathrin-mediated endocytosis. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross abnormalities. Mice homozygous null for both Epn1 and Epn2 display defects in angiogenic vascular remodeling, impaired somitogenesis and extensive cell death in the nervous tissue, resulting in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530003J23Rik G A 10: 117,238,697 probably benign Het
Acacb T C 5: 114,195,642 V542A possibly damaging Het
Adprhl1 C T 8: 13,223,069 V1230I probably benign Het
Agpat1 T A 17: 34,610,909 Y77N probably damaging Het
Apc T A 18: 34,312,073 I674K probably damaging Het
Arpc5 T C 1: 152,771,436 S97P probably damaging Het
Arrdc5 A G 17: 56,297,931 F119L probably benign Het
Asap1 A G 15: 64,130,256 V402A probably damaging Het
Aspg T C 12: 112,124,821 V479A possibly damaging Het
B3galnt2 G A 13: 13,994,485 V368M probably benign Het
Bcl3 T C 7: 19,822,611 T23A probably benign Het
Bpifb5 A G 2: 154,228,933 K215E possibly damaging Het
Coa4 T A 7: 100,539,271 C64S probably damaging Het
Dcun1d4 T C 5: 73,491,536 probably null Het
Dnaaf5 T G 5: 139,166,113 C506W probably damaging Het
Dock3 A G 9: 107,023,732 Y345H probably damaging Het
Dscaml1 A G 9: 45,710,326 N1024S possibly damaging Het
Dsp T C 13: 38,176,502 probably null Het
Dsp A G 13: 38,195,449 T2057A probably benign Het
Dync1h1 T G 12: 110,636,453 L2176R probably damaging Het
Eif5b A C 1: 38,051,637 D1192A probably benign Het
Exoc1 T A 5: 76,545,348 N360K probably benign Het
Fam135b A T 15: 71,463,680 V555E probably damaging Het
Fam208a T A 14: 27,471,645 V934E probably damaging Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Gcc2 A G 10: 58,256,901 T48A probably benign Het
Gm438 T C 4: 144,777,762 D273G probably damaging Het
Gm6619 T G 6: 131,490,391 I73S possibly damaging Het
Gm8267 T A 14: 44,722,940 D116V probably damaging Het
Hapln3 T A 7: 79,117,269 T341S probably benign Het
Lamb3 C A 1: 193,332,166 D544E possibly damaging Het
Lhx5 T A 5: 120,440,284 S390T probably benign Het
Lrrc63 A G 14: 75,126,257 S145P possibly damaging Het
Lrriq1 T C 10: 103,214,519 M791V probably benign Het
Lyg2 A G 1: 37,911,137 Y37H possibly damaging Het
Nrbp1 T A 5: 31,244,956 M172K probably damaging Het
Olfr1044 T A 2: 86,171,010 D269V probably damaging Het
Olfr1261 A G 2: 89,993,839 I149V probably benign Het
Olfr168 T G 16: 19,530,900 S7R probably benign Het
Pcyt2 A T 11: 120,611,383 Y308N possibly damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Phf21b A G 15: 84,804,903 S141P probably damaging Het
Pigh G A 12: 79,089,550 P24S probably benign Het
Plekhg3 A G 12: 76,576,485 D834G probably damaging Het
Plekhg5 T A 4: 152,113,935 V860D probably benign Het
Pon1 A G 6: 5,177,399 I170T probably damaging Het
Ptpn9 T A 9: 57,027,433 Y160* probably null Het
Ptprj T C 2: 90,449,819 K1045R possibly damaging Het
Rilpl2 T A 5: 124,463,788 H196L probably benign Het
Rnf112 C T 11: 61,451,028 V317I possibly damaging Het
Rundc3a G T 11: 102,400,046 probably null Het
Sgsm1 T C 5: 113,274,321 Y489C probably damaging Het
Sis G A 3: 72,909,041 H1531Y possibly damaging Het
Slc26a9 A G 1: 131,762,818 Y520C probably damaging Het
Smc5 A G 19: 23,242,700 V467A probably damaging Het
Spata20 G A 11: 94,484,041 A245V probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Sucnr1 A G 3: 60,086,696 Q215R probably benign Het
Supv3l1 G A 10: 62,430,615 A594V probably damaging Het
Swt1 A T 1: 151,411,064 F226I probably benign Het
Taar7f A G 10: 24,049,987 T160A possibly damaging Het
Tada2a A T 11: 84,126,986 probably null Het
Taok3 C A 5: 117,250,909 Q460K probably damaging Het
Twf2 A G 9: 106,214,398 E268G probably damaging Het
Upf2 A T 2: 6,018,932 I698F unknown Het
Vmn2r35 T A 7: 7,817,014 N86Y probably damaging Het
Vmn2r84 T C 10: 130,392,113 T85A possibly damaging Het
Vps13d A G 4: 145,105,856 S2833P Het
Xrn1 T C 9: 96,051,629 S1584P probably benign Het
Zfp354b T C 11: 50,922,397 Y567C probably damaging Het
Zfp52 A T 17: 21,560,870 R327* probably null Het
Other mutations in Epn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Epn2 APN 11 61523086 missense probably benign 0.00
IGL01582:Epn2 APN 11 61521869 missense probably benign 0.00
IGL02375:Epn2 APN 11 61519671 missense probably damaging 1.00
IGL03213:Epn2 APN 11 61519684 missense probably damaging 0.99
Ipanema UTSW 11 61519558 missense probably benign 0.00
R0400:Epn2 UTSW 11 61532696 splice site probably null
R0458:Epn2 UTSW 11 61546455 missense possibly damaging 0.89
R0471:Epn2 UTSW 11 61535308 missense probably damaging 1.00
R0833:Epn2 UTSW 11 61519491 missense probably benign 0.01
R0836:Epn2 UTSW 11 61519491 missense probably benign 0.01
R1418:Epn2 UTSW 11 61523086 missense probably benign 0.00
R1699:Epn2 UTSW 11 61523188 nonsense probably null
R1743:Epn2 UTSW 11 61546411 missense possibly damaging 0.92
R4039:Epn2 UTSW 11 61546522 missense probably damaging 1.00
R4696:Epn2 UTSW 11 61535303 missense probably damaging 1.00
R4752:Epn2 UTSW 11 61546371 missense probably damaging 1.00
R4913:Epn2 UTSW 11 61534576 critical splice donor site probably null
R6053:Epn2 UTSW 11 61546497 missense probably damaging 1.00
R6302:Epn2 UTSW 11 61546486 missense probably damaging 1.00
R6455:Epn2 UTSW 11 61533641 missense probably damaging 1.00
R6669:Epn2 UTSW 11 61519558 missense probably benign 0.00
R7032:Epn2 UTSW 11 61546702 missense probably damaging 1.00
R8008:Epn2 UTSW 11 61546666 missense probably damaging 1.00
R8128:Epn2 UTSW 11 61522495 splice site probably null
Z1177:Epn2 UTSW 11 61546424 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATCAGAGAGCTGGATGG -3'
(R):5'- GTGGCATTTCTGACCTGATCTTAG -3'

Sequencing Primer
(F):5'- CCACGGGTCATTGGAGGTG -3'
(R):5'- GACCTGATCTTAGTTTTGAAAGCAGG -3'
Posted On2019-10-07