Incidental Mutation 'R7439:Tada2a'
ID 576839
Institutional Source Beutler Lab
Gene Symbol Tada2a
Ensembl Gene ENSMUSG00000018651
Gene Name transcriptional adaptor 2A
Synonyms Tada2l, D030022J10Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.820) question?
Stock # R7439 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 84078920-84129600 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 84126986 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000018795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018795] [ENSMUST00000133811]
AlphaFold Q8CHV6
PDB Structure Structural and functional analysis of ada2 alpha swirm domain [SOLUTION NMR]
Structural and functional analysis of ADA2 alpha swirm domain [SOLUTION NMR]
Solution structure of SWIRM domain of mouse transcriptional adaptor 2-like [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000018795
SMART Domains Protein: ENSMUSP00000018795
Gene: ENSMUSG00000018651

DomainStartEndE-ValueType
Blast:ZnF_ZZ 11 57 2e-25 BLAST
SANT 71 120 3.1e-10 SMART
low complexity region 134 143 N/A INTRINSIC
Pfam:SWIRM 364 441 5.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133811
SMART Domains Protein: ENSMUSP00000116174
Gene: ENSMUSG00000020532

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PDB:2YL2|B 115 157 2e-21 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Many DNA-binding transcriptional activator proteins enhance the initiation rate of RNA polymerase II-mediated gene transcription by interacting functionally with the general transcription machinery bound at the basal promoter. Adaptor proteins are usually required for this activation, possibly to acetylate and destabilize nucleosomes, thereby relieving chromatin constraints at the promoter. The protein encoded by this gene is a transcriptional activator adaptor and has been found to be part of the PCAF histone acetylase complex. Several alternatively spliced transcript variants encoding different isoforms of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530003J23Rik G A 10: 117,238,697 probably benign Het
Acacb T C 5: 114,195,642 V542A possibly damaging Het
Adprhl1 C T 8: 13,223,069 V1230I probably benign Het
Agpat1 T A 17: 34,610,909 Y77N probably damaging Het
Apc T A 18: 34,312,073 I674K probably damaging Het
Arpc5 T C 1: 152,771,436 S97P probably damaging Het
Arrdc5 A G 17: 56,297,931 F119L probably benign Het
Asap1 A G 15: 64,130,256 V402A probably damaging Het
Aspg T C 12: 112,124,821 V479A possibly damaging Het
B3galnt2 G A 13: 13,994,485 V368M probably benign Het
Bcl3 T C 7: 19,822,611 T23A probably benign Het
Bpifb5 A G 2: 154,228,933 K215E possibly damaging Het
Coa4 T A 7: 100,539,271 C64S probably damaging Het
Dcun1d4 T C 5: 73,491,536 probably null Het
Dnaaf5 T G 5: 139,166,113 C506W probably damaging Het
Dock3 A G 9: 107,023,732 Y345H probably damaging Het
Dscaml1 A G 9: 45,710,326 N1024S possibly damaging Het
Dsp T C 13: 38,176,502 probably null Het
Dsp A G 13: 38,195,449 T2057A probably benign Het
Dync1h1 T G 12: 110,636,453 L2176R probably damaging Het
Eif5b A C 1: 38,051,637 D1192A probably benign Het
Epn2 A T 11: 61,546,848 probably benign Het
Exoc1 T A 5: 76,545,348 N360K probably benign Het
Fam135b A T 15: 71,463,680 V555E probably damaging Het
Fam208a T A 14: 27,471,645 V934E probably damaging Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Gcc2 A G 10: 58,256,901 T48A probably benign Het
Gm438 T C 4: 144,777,762 D273G probably damaging Het
Gm6619 T G 6: 131,490,391 I73S possibly damaging Het
Gm8267 T A 14: 44,722,940 D116V probably damaging Het
Hapln3 T A 7: 79,117,269 T341S probably benign Het
Lamb3 C A 1: 193,332,166 D544E possibly damaging Het
Lhx5 T A 5: 120,440,284 S390T probably benign Het
Lrrc63 A G 14: 75,126,257 S145P possibly damaging Het
Lrriq1 T C 10: 103,214,519 M791V probably benign Het
Lyg2 A G 1: 37,911,137 Y37H possibly damaging Het
Nrbp1 T A 5: 31,244,956 M172K probably damaging Het
Olfr1044 T A 2: 86,171,010 D269V probably damaging Het
Olfr1261 A G 2: 89,993,839 I149V probably benign Het
Olfr168 T G 16: 19,530,900 S7R probably benign Het
Pcyt2 A T 11: 120,611,383 Y308N possibly damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Phf21b A G 15: 84,804,903 S141P probably damaging Het
Pigh G A 12: 79,089,550 P24S probably benign Het
Plekhg3 A G 12: 76,576,485 D834G probably damaging Het
Plekhg5 T A 4: 152,113,935 V860D probably benign Het
Pon1 A G 6: 5,177,399 I170T probably damaging Het
Ptpn9 T A 9: 57,027,433 Y160* probably null Het
Ptprj T C 2: 90,449,819 K1045R possibly damaging Het
Rilpl2 T A 5: 124,463,788 H196L probably benign Het
Rnf112 C T 11: 61,451,028 V317I possibly damaging Het
Rundc3a G T 11: 102,400,046 probably null Het
Sgsm1 T C 5: 113,274,321 Y489C probably damaging Het
Sis G A 3: 72,909,041 H1531Y possibly damaging Het
Slc26a9 A G 1: 131,762,818 Y520C probably damaging Het
Smc5 A G 19: 23,242,700 V467A probably damaging Het
Spata20 G A 11: 94,484,041 A245V probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Sucnr1 A G 3: 60,086,696 Q215R probably benign Het
Supv3l1 G A 10: 62,430,615 A594V probably damaging Het
Swt1 A T 1: 151,411,064 F226I probably benign Het
Taar7f A G 10: 24,049,987 T160A possibly damaging Het
Taok3 C A 5: 117,250,909 Q460K probably damaging Het
Twf2 A G 9: 106,214,398 E268G probably damaging Het
Upf2 A T 2: 6,018,932 I698F unknown Het
Vmn2r35 T A 7: 7,817,014 N86Y probably damaging Het
Vmn2r84 T C 10: 130,392,113 T85A possibly damaging Het
Vps13d A G 4: 145,105,856 S2833P Het
Xrn1 T C 9: 96,051,629 S1584P probably benign Het
Zfp354b T C 11: 50,922,397 Y567C probably damaging Het
Zfp52 A T 17: 21,560,870 R327* probably null Het
Other mutations in Tada2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03256:Tada2a APN 11 84087192 splice site probably benign
PIT4131001:Tada2a UTSW 11 84079737 missense probably damaging 0.98
R1438:Tada2a UTSW 11 84110011 missense probably damaging 0.99
R1615:Tada2a UTSW 11 84103100 missense probably damaging 1.00
R1688:Tada2a UTSW 11 84084759 critical splice acceptor site probably null
R1693:Tada2a UTSW 11 84082069 missense probably damaging 1.00
R2146:Tada2a UTSW 11 84079629 missense probably damaging 1.00
R2147:Tada2a UTSW 11 84079629 missense probably damaging 1.00
R2150:Tada2a UTSW 11 84079629 missense probably damaging 1.00
R3980:Tada2a UTSW 11 84103120 missense probably benign 0.41
R5364:Tada2a UTSW 11 84121147 missense probably benign
R5686:Tada2a UTSW 11 84079602 missense possibly damaging 0.59
R7117:Tada2a UTSW 11 84085688 missense probably damaging 0.99
Z1177:Tada2a UTSW 11 84093667 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- ATGAAGCTGTGCCACATTCAG -3'
(R):5'- GAGGCTGCACTTCACATTCTG -3'

Sequencing Primer
(F):5'- TGTGCCACATTCAGTAGGC -3'
(R):5'- ACCACACAGTTGCCGTGTC -3'
Posted On 2019-10-07