Incidental Mutation 'R7439:Plekhg3'
ID 576843
Institutional Source Beutler Lab
Gene Symbol Plekhg3
Ensembl Gene ENSMUSG00000052609
Gene Name pleckstrin homology domain containing, family G (with RhoGef domain) member 3
Synonyms MGC40768
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7439 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 76530891-76580488 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 76576485 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 834 (D834G)
Ref Sequence ENSEMBL: ENSMUSP00000074729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021458] [ENSMUST00000075249] [ENSMUST00000219063]
AlphaFold Q4VAC9
Predicted Effect probably benign
Transcript: ENSMUST00000021458
SMART Domains Protein: ENSMUSP00000021458
Gene: ENSMUSG00000021061

DomainStartEndE-ValueType
CH 56 156 2.73e-26 SMART
CH 175 273 4.57e-28 SMART
SPEC 305 411 2.71e0 SMART
SPEC 425 525 4.65e-23 SMART
SPEC 531 634 4.51e-21 SMART
SPEC 640 740 3.02e-31 SMART
SPEC 746 845 1.47e-20 SMART
SPEC 851 951 1.04e-20 SMART
SPEC 957 1058 7.22e-20 SMART
SPEC 1064 1165 2.06e-24 SMART
SPEC 1171 1271 3.84e-15 SMART
SPEC 1277 1376 2.22e-20 SMART
SPEC 1382 1475 5.04e-10 SMART
SPEC 1481 1581 3.58e-24 SMART
SPEC 1587 1687 4.11e-24 SMART
SPEC 1693 1794 2.91e-24 SMART
SPEC 1800 1900 7.8e-16 SMART
SPEC 1906 2006 3.16e-25 SMART
SPEC 2012 2193 4.32e-9 SMART
PH 2180 2291 8.98e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000075249
AA Change: D834G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074729
Gene: ENSMUSG00000052609
AA Change: D834G

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
RhoGEF 97 271 6.67e-51 SMART
PH 297 396 2.48e-9 SMART
coiled coil region 515 552 N/A INTRINSIC
low complexity region 563 585 N/A INTRINSIC
low complexity region 696 710 N/A INTRINSIC
low complexity region 727 737 N/A INTRINSIC
low complexity region 753 766 N/A INTRINSIC
low complexity region 978 993 N/A INTRINSIC
low complexity region 1233 1246 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000219063
AA Change: D833G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530003J23Rik G A 10: 117,238,697 probably benign Het
Acacb T C 5: 114,195,642 V542A possibly damaging Het
Adprhl1 C T 8: 13,223,069 V1230I probably benign Het
Agpat1 T A 17: 34,610,909 Y77N probably damaging Het
Apc T A 18: 34,312,073 I674K probably damaging Het
Arpc5 T C 1: 152,771,436 S97P probably damaging Het
Arrdc5 A G 17: 56,297,931 F119L probably benign Het
Asap1 A G 15: 64,130,256 V402A probably damaging Het
Aspg T C 12: 112,124,821 V479A possibly damaging Het
B3galnt2 G A 13: 13,994,485 V368M probably benign Het
Bcl3 T C 7: 19,822,611 T23A probably benign Het
Bpifb5 A G 2: 154,228,933 K215E possibly damaging Het
Coa4 T A 7: 100,539,271 C64S probably damaging Het
Dcun1d4 T C 5: 73,491,536 probably null Het
Dnaaf5 T G 5: 139,166,113 C506W probably damaging Het
Dock3 A G 9: 107,023,732 Y345H probably damaging Het
Dscaml1 A G 9: 45,710,326 N1024S possibly damaging Het
Dsp T C 13: 38,176,502 probably null Het
Dsp A G 13: 38,195,449 T2057A probably benign Het
Dync1h1 T G 12: 110,636,453 L2176R probably damaging Het
Eif5b A C 1: 38,051,637 D1192A probably benign Het
Epn2 A T 11: 61,546,848 probably benign Het
Exoc1 T A 5: 76,545,348 N360K probably benign Het
Fam135b A T 15: 71,463,680 V555E probably damaging Het
Fam208a T A 14: 27,471,645 V934E probably damaging Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Gcc2 A G 10: 58,256,901 T48A probably benign Het
Gm438 T C 4: 144,777,762 D273G probably damaging Het
Gm6619 T G 6: 131,490,391 I73S possibly damaging Het
Gm8267 T A 14: 44,722,940 D116V probably damaging Het
Hapln3 T A 7: 79,117,269 T341S probably benign Het
Lamb3 C A 1: 193,332,166 D544E possibly damaging Het
Lhx5 T A 5: 120,440,284 S390T probably benign Het
Lrrc63 A G 14: 75,126,257 S145P possibly damaging Het
Lrriq1 T C 10: 103,214,519 M791V probably benign Het
Lyg2 A G 1: 37,911,137 Y37H possibly damaging Het
Nrbp1 T A 5: 31,244,956 M172K probably damaging Het
Olfr1044 T A 2: 86,171,010 D269V probably damaging Het
Olfr1261 A G 2: 89,993,839 I149V probably benign Het
Olfr168 T G 16: 19,530,900 S7R probably benign Het
Pcyt2 A T 11: 120,611,383 Y308N possibly damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Phf21b A G 15: 84,804,903 S141P probably damaging Het
Pigh G A 12: 79,089,550 P24S probably benign Het
Plekhg5 T A 4: 152,113,935 V860D probably benign Het
Pon1 A G 6: 5,177,399 I170T probably damaging Het
Ptpn9 T A 9: 57,027,433 Y160* probably null Het
Ptprj T C 2: 90,449,819 K1045R possibly damaging Het
Rilpl2 T A 5: 124,463,788 H196L probably benign Het
Rnf112 C T 11: 61,451,028 V317I possibly damaging Het
Rundc3a G T 11: 102,400,046 probably null Het
Sgsm1 T C 5: 113,274,321 Y489C probably damaging Het
Sis G A 3: 72,909,041 H1531Y possibly damaging Het
Slc26a9 A G 1: 131,762,818 Y520C probably damaging Het
Smc5 A G 19: 23,242,700 V467A probably damaging Het
Spata20 G A 11: 94,484,041 A245V probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Sucnr1 A G 3: 60,086,696 Q215R probably benign Het
Supv3l1 G A 10: 62,430,615 A594V probably damaging Het
Swt1 A T 1: 151,411,064 F226I probably benign Het
Taar7f A G 10: 24,049,987 T160A possibly damaging Het
Tada2a A T 11: 84,126,986 probably null Het
Taok3 C A 5: 117,250,909 Q460K probably damaging Het
Twf2 A G 9: 106,214,398 E268G probably damaging Het
Upf2 A T 2: 6,018,932 I698F unknown Het
Vmn2r35 T A 7: 7,817,014 N86Y probably damaging Het
Vmn2r84 T C 10: 130,392,113 T85A possibly damaging Het
Vps13d A G 4: 145,105,856 S2833P Het
Xrn1 T C 9: 96,051,629 S1584P probably benign Het
Zfp354b T C 11: 50,922,397 Y567C probably damaging Het
Zfp52 A T 17: 21,560,870 R327* probably null Het
Other mutations in Plekhg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01079:Plekhg3 APN 12 76562278 missense possibly damaging 0.78
IGL01143:Plekhg3 APN 12 76564982 critical splice donor site probably null
IGL02079:Plekhg3 APN 12 76560429 missense probably benign 0.01
IGL02349:Plekhg3 APN 12 76562300 missense probably damaging 1.00
IGL02442:Plekhg3 APN 12 76578353 missense probably benign 0.01
IGL02570:Plekhg3 APN 12 76578245 missense probably benign
flagging UTSW 12 76560520 critical splice donor site probably null
R0667_Plekhg3_072 UTSW 12 76576598 missense probably damaging 1.00
trailing UTSW 12 76564961 missense probably benign 0.15
R0344:Plekhg3 UTSW 12 76566266 nonsense probably null
R0667:Plekhg3 UTSW 12 76576598 missense probably damaging 1.00
R1269:Plekhg3 UTSW 12 76560469 missense probably damaging 1.00
R1566:Plekhg3 UTSW 12 76572065 missense possibly damaging 0.54
R1905:Plekhg3 UTSW 12 76576217 missense probably benign 0.05
R2885:Plekhg3 UTSW 12 76564961 missense probably benign 0.15
R2962:Plekhg3 UTSW 12 76572659 critical splice donor site probably null
R3784:Plekhg3 UTSW 12 76560520 critical splice donor site probably null
R3941:Plekhg3 UTSW 12 76573359 missense probably damaging 0.98
R4056:Plekhg3 UTSW 12 76565247 missense probably damaging 1.00
R4080:Plekhg3 UTSW 12 76577981 missense probably benign 0.02
R4412:Plekhg3 UTSW 12 76577764 missense probably damaging 0.96
R4413:Plekhg3 UTSW 12 76577764 missense probably damaging 0.96
R4704:Plekhg3 UTSW 12 76578238 missense probably damaging 1.00
R4720:Plekhg3 UTSW 12 76578322 missense possibly damaging 0.59
R4738:Plekhg3 UTSW 12 76576914 missense probably damaging 1.00
R4898:Plekhg3 UTSW 12 76564125 missense probably damaging 1.00
R4994:Plekhg3 UTSW 12 76565537 missense possibly damaging 0.68
R4999:Plekhg3 UTSW 12 76565247 missense possibly damaging 0.95
R5484:Plekhg3 UTSW 12 76578400 missense possibly damaging 0.76
R5591:Plekhg3 UTSW 12 76560292 missense possibly damaging 0.80
R6019:Plekhg3 UTSW 12 76577941 nonsense probably null
R6147:Plekhg3 UTSW 12 76565211 missense probably damaging 0.96
R6272:Plekhg3 UTSW 12 76576845 missense probably benign 0.00
R6482:Plekhg3 UTSW 12 76576004 missense probably benign 0.01
R7081:Plekhg3 UTSW 12 76578245 missense probably benign
R7349:Plekhg3 UTSW 12 76564565 missense probably benign 0.45
R7449:Plekhg3 UTSW 12 76566222 missense probably damaging 0.98
R7879:Plekhg3 UTSW 12 76565569 missense probably damaging 1.00
R8256:Plekhg3 UTSW 12 76562267 missense probably damaging 0.98
R8298:Plekhg3 UTSW 12 76577078 missense probably damaging 1.00
R8492:Plekhg3 UTSW 12 76576016 missense probably benign
R8886:Plekhg3 UTSW 12 76564974 missense possibly damaging 0.81
R9090:Plekhg3 UTSW 12 76575920 missense probably benign
R9117:Plekhg3 UTSW 12 76578131 missense probably benign
R9220:Plekhg3 UTSW 12 76572065 missense probably benign 0.18
R9271:Plekhg3 UTSW 12 76575920 missense probably benign
R9294:Plekhg3 UTSW 12 76562278 missense possibly damaging 0.78
R9394:Plekhg3 UTSW 12 76577088 missense probably damaging 0.99
R9468:Plekhg3 UTSW 12 76560235 missense probably damaging 0.98
R9711:Plekhg3 UTSW 12 76564952 missense possibly damaging 0.83
R9747:Plekhg3 UTSW 12 76564593 missense probably damaging 1.00
X0062:Plekhg3 UTSW 12 76573343 missense possibly damaging 0.89
Z1176:Plekhg3 UTSW 12 76575856 critical splice acceptor site probably null
Z1177:Plekhg3 UTSW 12 76578328 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGGACACCACGGCTTATC -3'
(R):5'- CTTGTACCCAACTGGAGCTG -3'

Sequencing Primer
(F):5'- TTATCAGCCGGAGCAGCAGTG -3'
(R):5'- CTGCTGGCTCTGAATCTGGC -3'
Posted On 2019-10-07