Incidental Mutation 'R7439:Fam135b'
ID 576854
Institutional Source Beutler Lab
Gene Symbol Fam135b
Ensembl Gene ENSMUSG00000036800
Gene Name family with sequence similarity 135, member B
Synonyms 1700010C24Rik, A830008O07Rik
MMRRC Submission 045515-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7439 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 71310800-71600282 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 71335529 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 555 (V555E)
Ref Sequence ENSEMBL: ENSMUSP00000022953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022953]
AlphaFold Q9DAI6
Predicted Effect probably damaging
Transcript: ENSMUST00000022953
AA Change: V555E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022953
Gene: ENSMUSG00000036800
AA Change: V555E

DomainStartEndE-ValueType
Pfam:DUF3657 111 172 1.9e-19 PFAM
low complexity region 744 757 N/A INTRINSIC
low complexity region 1124 1130 N/A INTRINSIC
Pfam:DUF676 1132 1328 2.7e-60 PFAM
Pfam:PGAP1 1135 1309 3.2e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm5 T C 4: 144,504,332 (GRCm39) D273G probably damaging Het
Acacb T C 5: 114,333,703 (GRCm39) V542A possibly damaging Het
Adprhl1 C T 8: 13,273,069 (GRCm39) V1230I probably benign Het
Agpat1 T A 17: 34,829,883 (GRCm39) Y77N probably damaging Het
Apc T A 18: 34,445,126 (GRCm39) I674K probably damaging Het
Arpc5 T C 1: 152,647,187 (GRCm39) S97P probably damaging Het
Arrdc5 A G 17: 56,604,931 (GRCm39) F119L probably benign Het
Asap1 A G 15: 64,002,105 (GRCm39) V402A probably damaging Het
Aspg T C 12: 112,091,255 (GRCm39) V479A possibly damaging Het
B3galnt2 G A 13: 14,169,070 (GRCm39) V368M probably benign Het
Bcl3 T C 7: 19,556,536 (GRCm39) T23A probably benign Het
Bpifb5 A G 2: 154,070,853 (GRCm39) K215E possibly damaging Het
Coa4 T A 7: 100,188,478 (GRCm39) C64S probably damaging Het
Dcun1d4 T C 5: 73,648,879 (GRCm39) probably null Het
Dnaaf5 T G 5: 139,151,868 (GRCm39) C506W probably damaging Het
Dock3 A G 9: 106,900,931 (GRCm39) Y345H probably damaging Het
Dscaml1 A G 9: 45,621,624 (GRCm39) N1024S possibly damaging Het
Dsp T C 13: 38,360,478 (GRCm39) probably null Het
Dsp A G 13: 38,379,425 (GRCm39) T2057A probably benign Het
Dync1h1 T G 12: 110,602,887 (GRCm39) L2176R probably damaging Het
Eif5b A C 1: 38,090,718 (GRCm39) D1192A probably benign Het
Epn2 A T 11: 61,437,674 (GRCm39) probably benign Het
Exoc1 T A 5: 76,693,195 (GRCm39) N360K probably benign Het
Fmn1 A T 2: 113,271,956 (GRCm39) Q108L unknown Het
Gcc2 A G 10: 58,092,723 (GRCm39) T48A probably benign Het
Gm6619 T G 6: 131,467,354 (GRCm39) I73S possibly damaging Het
Gm8267 T A 14: 44,960,397 (GRCm39) D116V probably damaging Het
Hapln3 T A 7: 78,767,017 (GRCm39) T341S probably benign Het
Lamb3 C A 1: 193,014,474 (GRCm39) D544E possibly damaging Het
Lhx5 T A 5: 120,578,349 (GRCm39) S390T probably benign Het
Lrrc63 A G 14: 75,363,697 (GRCm39) S145P possibly damaging Het
Lrriq1 T C 10: 103,050,380 (GRCm39) M791V probably benign Het
Lyg2 A G 1: 37,950,218 (GRCm39) Y37H possibly damaging Het
Lyz3 G A 10: 117,074,602 (GRCm39) probably benign Het
Nrbp1 T A 5: 31,402,300 (GRCm39) M172K probably damaging Het
Or2l13b T G 16: 19,349,650 (GRCm39) S7R probably benign Het
Or4c126 A G 2: 89,824,183 (GRCm39) I149V probably benign Het
Or8u9 T A 2: 86,001,354 (GRCm39) D269V probably damaging Het
Pcyt2 A T 11: 120,502,209 (GRCm39) Y308N possibly damaging Het
Peg10 C CTCA 6: 4,756,453 (GRCm39) probably benign Het
Phf21b A G 15: 84,689,104 (GRCm39) S141P probably damaging Het
Pigh G A 12: 79,136,324 (GRCm39) P24S probably benign Het
Plekhg3 A G 12: 76,623,259 (GRCm39) D834G probably damaging Het
Plekhg5 T A 4: 152,198,392 (GRCm39) V860D probably benign Het
Pon1 A G 6: 5,177,399 (GRCm39) I170T probably damaging Het
Ptpn9 T A 9: 56,934,717 (GRCm39) Y160* probably null Het
Ptprj T C 2: 90,280,163 (GRCm39) K1045R possibly damaging Het
Rilpl2 T A 5: 124,601,851 (GRCm39) H196L probably benign Het
Rnf112 C T 11: 61,341,854 (GRCm39) V317I possibly damaging Het
Rundc3a G T 11: 102,290,872 (GRCm39) probably null Het
Sgsm1 T C 5: 113,422,187 (GRCm39) Y489C probably damaging Het
Sis G A 3: 72,816,374 (GRCm39) H1531Y possibly damaging Het
Slc26a9 A G 1: 131,690,556 (GRCm39) Y520C probably damaging Het
Smc5 A G 19: 23,220,064 (GRCm39) V467A probably damaging Het
Spata20 G A 11: 94,374,867 (GRCm39) A245V probably benign Het
Steap3 A C 1: 120,169,248 (GRCm39) F350V probably benign Het
Sucnr1 A G 3: 59,994,117 (GRCm39) Q215R probably benign Het
Supv3l1 G A 10: 62,266,394 (GRCm39) A594V probably damaging Het
Swt1 A T 1: 151,286,815 (GRCm39) F226I probably benign Het
Taar7f A G 10: 23,925,885 (GRCm39) T160A possibly damaging Het
Tada2a A T 11: 84,017,812 (GRCm39) probably null Het
Taok3 C A 5: 117,388,974 (GRCm39) Q460K probably damaging Het
Tasor T A 14: 27,193,602 (GRCm39) V934E probably damaging Het
Twf2 A G 9: 106,091,597 (GRCm39) E268G probably damaging Het
Upf2 A T 2: 6,023,743 (GRCm39) I698F unknown Het
Vmn2r35 T A 7: 7,820,013 (GRCm39) N86Y probably damaging Het
Vmn2r84 T C 10: 130,227,982 (GRCm39) T85A possibly damaging Het
Vps13d A G 4: 144,832,426 (GRCm39) S2833P Het
Xrn1 T C 9: 95,933,682 (GRCm39) S1584P probably benign Het
Zfp354b T C 11: 50,813,224 (GRCm39) Y567C probably damaging Het
Zfp52 A T 17: 21,781,132 (GRCm39) R327* probably null Het
Other mutations in Fam135b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Fam135b APN 15 71,322,343 (GRCm39) missense probably damaging 1.00
IGL00565:Fam135b APN 15 71,343,361 (GRCm39) missense probably benign
IGL00645:Fam135b APN 15 71,334,395 (GRCm39) missense probably damaging 1.00
IGL00686:Fam135b APN 15 71,334,168 (GRCm39) missense probably benign 0.00
IGL00857:Fam135b APN 15 71,335,465 (GRCm39) missense probably benign 0.16
IGL01443:Fam135b APN 15 71,335,213 (GRCm39) missense probably benign 0.02
IGL01690:Fam135b APN 15 71,328,784 (GRCm39) missense probably benign 0.19
IGL01920:Fam135b APN 15 71,493,885 (GRCm39) missense possibly damaging 0.94
IGL01987:Fam135b APN 15 71,333,964 (GRCm39) missense probably benign
IGL02154:Fam135b APN 15 71,320,559 (GRCm39) missense probably benign 0.12
IGL03107:Fam135b APN 15 71,335,410 (GRCm39) missense probably benign
IGL03264:Fam135b APN 15 71,334,637 (GRCm39) missense probably benign
IGL03055:Fam135b UTSW 15 71,493,883 (GRCm39) missense possibly damaging 0.51
R0010:Fam135b UTSW 15 71,493,881 (GRCm39) missense probably damaging 1.00
R0010:Fam135b UTSW 15 71,493,881 (GRCm39) missense probably damaging 1.00
R0230:Fam135b UTSW 15 71,317,886 (GRCm39) missense probably benign 0.02
R0413:Fam135b UTSW 15 71,335,670 (GRCm39) missense probably benign 0.45
R0524:Fam135b UTSW 15 71,334,133 (GRCm39) missense probably benign 0.00
R0565:Fam135b UTSW 15 71,362,686 (GRCm39) missense possibly damaging 0.88
R0628:Fam135b UTSW 15 71,320,505 (GRCm39) splice site probably benign
R1415:Fam135b UTSW 15 71,328,777 (GRCm39) missense probably damaging 0.99
R1462:Fam135b UTSW 15 71,493,845 (GRCm39) splice site probably benign
R1701:Fam135b UTSW 15 71,331,578 (GRCm39) missense probably damaging 1.00
R1797:Fam135b UTSW 15 71,324,290 (GRCm39) missense probably benign 0.41
R1807:Fam135b UTSW 15 71,335,761 (GRCm39) missense probably benign
R1835:Fam135b UTSW 15 71,362,560 (GRCm39) missense probably damaging 1.00
R1905:Fam135b UTSW 15 71,404,836 (GRCm39) missense probably damaging 1.00
R1937:Fam135b UTSW 15 71,493,863 (GRCm39) missense probably damaging 1.00
R1998:Fam135b UTSW 15 71,324,253 (GRCm39) missense probably damaging 0.98
R2076:Fam135b UTSW 15 71,350,092 (GRCm39) missense probably damaging 0.99
R2518:Fam135b UTSW 15 71,335,760 (GRCm39) missense probably benign 0.00
R3110:Fam135b UTSW 15 71,335,879 (GRCm39) missense probably benign 0.05
R3112:Fam135b UTSW 15 71,335,879 (GRCm39) missense probably benign 0.05
R3932:Fam135b UTSW 15 71,322,280 (GRCm39) missense probably benign 0.29
R4361:Fam135b UTSW 15 71,362,676 (GRCm39) missense probably damaging 1.00
R4397:Fam135b UTSW 15 71,320,525 (GRCm39) missense probably benign 0.17
R4435:Fam135b UTSW 15 71,320,588 (GRCm39) missense probably damaging 1.00
R4645:Fam135b UTSW 15 71,334,189 (GRCm39) missense probably benign
R4740:Fam135b UTSW 15 71,335,920 (GRCm39) missense probably benign 0.01
R4748:Fam135b UTSW 15 71,335,904 (GRCm39) missense probably benign 0.00
R4754:Fam135b UTSW 15 71,334,800 (GRCm39) missense probably benign 0.01
R5044:Fam135b UTSW 15 71,334,560 (GRCm39) missense probably benign 0.02
R5469:Fam135b UTSW 15 71,317,892 (GRCm39) missense probably benign 0.16
R5617:Fam135b UTSW 15 71,493,865 (GRCm39) missense probably damaging 1.00
R5642:Fam135b UTSW 15 71,333,985 (GRCm39) missense probably damaging 1.00
R5778:Fam135b UTSW 15 71,350,881 (GRCm39) missense probably damaging 1.00
R5891:Fam135b UTSW 15 71,397,652 (GRCm39) missense probably damaging 1.00
R5958:Fam135b UTSW 15 71,334,744 (GRCm39) missense
R5982:Fam135b UTSW 15 71,320,518 (GRCm39) critical splice donor site probably null
R5987:Fam135b UTSW 15 71,362,697 (GRCm39) missense probably benign 0.00
R6535:Fam135b UTSW 15 71,493,924 (GRCm39) missense probably damaging 0.99
R6734:Fam135b UTSW 15 71,334,629 (GRCm39) missense probably benign 0.02
R6887:Fam135b UTSW 15 71,335,164 (GRCm39) missense probably damaging 1.00
R7028:Fam135b UTSW 15 71,343,412 (GRCm39) missense probably damaging 1.00
R7035:Fam135b UTSW 15 71,334,102 (GRCm39) missense possibly damaging 0.77
R7097:Fam135b UTSW 15 71,493,917 (GRCm39) missense possibly damaging 0.92
R7143:Fam135b UTSW 15 71,351,000 (GRCm39) missense probably benign 0.44
R7414:Fam135b UTSW 15 71,350,105 (GRCm39) missense probably damaging 0.97
R7441:Fam135b UTSW 15 71,335,529 (GRCm39) missense probably damaging 0.98
R7545:Fam135b UTSW 15 71,322,359 (GRCm39) missense possibly damaging 0.95
R7615:Fam135b UTSW 15 71,335,172 (GRCm39) missense probably damaging 1.00
R7642:Fam135b UTSW 15 71,350,991 (GRCm39) missense possibly damaging 0.51
R7649:Fam135b UTSW 15 71,334,429 (GRCm39) missense probably benign 0.00
R7686:Fam135b UTSW 15 71,335,233 (GRCm39) missense possibly damaging 0.68
R7866:Fam135b UTSW 15 71,333,925 (GRCm39) missense probably benign 0.00
R8006:Fam135b UTSW 15 71,334,183 (GRCm39) missense probably benign 0.00
R8068:Fam135b UTSW 15 71,404,827 (GRCm39) missense probably damaging 1.00
R8167:Fam135b UTSW 15 71,404,840 (GRCm39) missense probably null 1.00
R8252:Fam135b UTSW 15 71,404,872 (GRCm39) missense probably benign 0.10
R8548:Fam135b UTSW 15 71,334,659 (GRCm39) missense probably damaging 0.99
R8833:Fam135b UTSW 15 71,334,783 (GRCm39) missense probably benign 0.04
R8955:Fam135b UTSW 15 71,334,063 (GRCm39) missense possibly damaging 0.85
R8961:Fam135b UTSW 15 71,404,812 (GRCm39) missense probably damaging 1.00
R8987:Fam135b UTSW 15 71,334,189 (GRCm39) missense probably benign 0.00
R9149:Fam135b UTSW 15 71,334,744 (GRCm39) missense
R9161:Fam135b UTSW 15 71,334,417 (GRCm39) missense possibly damaging 0.91
R9227:Fam135b UTSW 15 71,335,856 (GRCm39) missense probably benign 0.28
R9230:Fam135b UTSW 15 71,335,856 (GRCm39) missense probably benign 0.28
R9365:Fam135b UTSW 15 71,334,813 (GRCm39) missense probably benign 0.00
R9622:Fam135b UTSW 15 71,397,686 (GRCm39) missense probably damaging 0.98
R9758:Fam135b UTSW 15 71,324,199 (GRCm39) missense probably benign 0.28
R9759:Fam135b UTSW 15 71,335,689 (GRCm39) missense probably benign 0.44
T0722:Fam135b UTSW 15 71,335,734 (GRCm39) missense probably damaging 1.00
T0975:Fam135b UTSW 15 71,335,734 (GRCm39) missense probably damaging 1.00
Z1177:Fam135b UTSW 15 71,493,925 (GRCm39) start codon destroyed probably null 0.06
Predicted Primers PCR Primer
(F):5'- GGCTTTCCATCCTGGTTGAC -3'
(R):5'- GCTCAGAATCTCAGGTGTACC -3'

Sequencing Primer
(F):5'- GGTTGACTCCCCTCCCTAGAG -3'
(R):5'- GTACCTGACCATTGGTGAATTTC -3'
Posted On 2019-10-07