Incidental Mutation 'R7439:Agpat1'
ID576858
Institutional Source Beutler Lab
Gene Symbol Agpat1
Ensembl Gene ENSMUSG00000034254
Gene Name1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha)
SynonymsLpaat-alpha, 1-AGP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.888) question?
Stock #R7439 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location34604262-34613449 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34610909 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 77 (Y77N)
Ref Sequence ENSEMBL: ENSMUSP00000048573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015611] [ENSMUST00000037489] [ENSMUST00000097345] [ENSMUST00000114140] [ENSMUST00000168353] [ENSMUST00000173242] [ENSMUST00000173973] [ENSMUST00000174041] [ENSMUST00000174228] [ENSMUST00000174595]
Predicted Effect probably benign
Transcript: ENSMUST00000015611
SMART Domains Protein: ENSMUSP00000015611
Gene: ENSMUSG00000015467

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:EMI 36 102 4.3e-20 PFAM
EGF 113 142 5.49e-3 SMART
EGF_CA 144 184 2.58e-8 SMART
coiled coil region 206 228 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000037489
AA Change: Y77N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000048573
Gene: ENSMUSG00000034254
AA Change: Y77N

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 66 71 N/A INTRINSIC
PlsC 95 210 4.64e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097345
SMART Domains Protein: ENSMUSP00000094958
Gene: ENSMUSG00000015467

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:EMI 34 104 3e-16 PFAM
EGF 113 142 5.49e-3 SMART
EGF_CA 144 184 2.58e-8 SMART
coiled coil region 206 228 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114140
AA Change: Y77N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109776
Gene: ENSMUSG00000034254
AA Change: Y77N

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 66 71 N/A INTRINSIC
PlsC 95 210 4.64e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168353
SMART Domains Protein: ENSMUSP00000128433
Gene: ENSMUSG00000015467

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:EMI 34 104 7.4e-16 PFAM
EGF 113 142 5.49e-3 SMART
EGF_CA 144 184 2.58e-8 SMART
coiled coil region 206 228 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173242
AA Change: Y77N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134242
Gene: ENSMUSG00000034254
AA Change: Y77N

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
low complexity region 66 71 N/A INTRINSIC
Pfam:Acyltransferase 80 149 1.2e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173973
AA Change: Y77N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133947
Gene: ENSMUSG00000034254
AA Change: Y77N

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
low complexity region 66 71 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174041
AA Change: Y77N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133441
Gene: ENSMUSG00000034254
AA Change: Y77N

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 66 71 N/A INTRINSIC
PlsC 95 198 6.63e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174228
SMART Domains Protein: ENSMUSP00000133876
Gene: ENSMUSG00000034254

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174595
AA Change: Y77N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134358
Gene: ENSMUSG00000034254
AA Change: Y77N

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 66 71 N/A INTRINSIC
PlsC 95 210 4.64e-42 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that converts lysophosphatidic acid (LPA) into phosphatidic acid (PA). LPA and PA are two phospholipids involved in signal transduction and in lipid biosynthesis in cells. This enzyme localizes to the endoplasmic reticulum. This gene is located in the class III region of the human major histocompatibility complex. Alternative splicing results in two transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530003J23Rik G A 10: 117,238,697 probably benign Het
Acacb T C 5: 114,195,642 V542A possibly damaging Het
Adprhl1 C T 8: 13,223,069 V1230I probably benign Het
Apc T A 18: 34,312,073 I674K probably damaging Het
Arpc5 T C 1: 152,771,436 S97P probably damaging Het
Arrdc5 A G 17: 56,297,931 F119L probably benign Het
Asap1 A G 15: 64,130,256 V402A probably damaging Het
Aspg T C 12: 112,124,821 V479A possibly damaging Het
B3galnt2 G A 13: 13,994,485 V368M probably benign Het
Bcl3 T C 7: 19,822,611 T23A probably benign Het
Bpifb5 A G 2: 154,228,933 K215E possibly damaging Het
Coa4 T A 7: 100,539,271 C64S probably damaging Het
Dcun1d4 T C 5: 73,491,536 probably null Het
Dnaaf5 T G 5: 139,166,113 C506W probably damaging Het
Dock3 A G 9: 107,023,732 Y345H probably damaging Het
Dscaml1 A G 9: 45,710,326 N1024S possibly damaging Het
Dsp T C 13: 38,176,502 probably null Het
Dsp A G 13: 38,195,449 T2057A probably benign Het
Dync1h1 T G 12: 110,636,453 L2176R probably damaging Het
Eif5b A C 1: 38,051,637 D1192A probably benign Het
Epn2 A T 11: 61,546,848 probably benign Het
Exoc1 T A 5: 76,545,348 N360K probably benign Het
Fam135b A T 15: 71,463,680 V555E probably damaging Het
Fam208a T A 14: 27,471,645 V934E probably damaging Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Gcc2 A G 10: 58,256,901 T48A probably benign Het
Gm438 T C 4: 144,777,762 D273G probably damaging Het
Gm6619 T G 6: 131,490,391 I73S possibly damaging Het
Gm8267 T A 14: 44,722,940 D116V probably damaging Het
Hapln3 T A 7: 79,117,269 T341S probably benign Het
Lamb3 C A 1: 193,332,166 D544E possibly damaging Het
Lhx5 T A 5: 120,440,284 S390T probably benign Het
Lrrc63 A G 14: 75,126,257 S145P possibly damaging Het
Lrriq1 T C 10: 103,214,519 M791V probably benign Het
Lyg2 A G 1: 37,911,137 Y37H possibly damaging Het
Nrbp1 T A 5: 31,244,956 M172K probably damaging Het
Olfr1044 T A 2: 86,171,010 D269V probably damaging Het
Olfr1261 A G 2: 89,993,839 I149V probably benign Het
Olfr168 T G 16: 19,530,900 S7R probably benign Het
Pcyt2 A T 11: 120,611,383 Y308N possibly damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Phf21b A G 15: 84,804,903 S141P probably damaging Het
Pigh G A 12: 79,089,550 P24S probably benign Het
Plekhg3 A G 12: 76,576,485 D834G probably damaging Het
Plekhg5 T A 4: 152,113,935 V860D probably benign Het
Pon1 A G 6: 5,177,399 I170T probably damaging Het
Ptpn9 T A 9: 57,027,433 Y160* probably null Het
Ptprj T C 2: 90,449,819 K1045R possibly damaging Het
Rilpl2 T A 5: 124,463,788 H196L probably benign Het
Rnf112 C T 11: 61,451,028 V317I possibly damaging Het
Rundc3a G T 11: 102,400,046 probably null Het
Sgsm1 T C 5: 113,274,321 Y489C probably damaging Het
Sis G A 3: 72,909,041 H1531Y possibly damaging Het
Slc26a9 A G 1: 131,762,818 Y520C probably damaging Het
Smc5 A G 19: 23,242,700 V467A probably damaging Het
Spata20 G A 11: 94,484,041 A245V probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Sucnr1 A G 3: 60,086,696 Q215R probably benign Het
Supv3l1 G A 10: 62,430,615 A594V probably damaging Het
Swt1 A T 1: 151,411,064 F226I probably benign Het
Taar7f A G 10: 24,049,987 T160A possibly damaging Het
Tada2a A T 11: 84,126,986 probably null Het
Taok3 C A 5: 117,250,909 Q460K probably damaging Het
Twf2 A G 9: 106,214,398 E268G probably damaging Het
Upf2 A T 2: 6,018,932 I698F unknown Het
Vmn2r35 T A 7: 7,817,014 N86Y probably damaging Het
Vmn2r84 T C 10: 130,392,113 T85A possibly damaging Het
Vps13d A G 4: 145,105,856 S2833P Het
Xrn1 T C 9: 96,051,629 S1584P probably benign Het
Zfp354b T C 11: 50,922,397 Y567C probably damaging Het
Zfp52 A T 17: 21,560,870 R327* probably null Het
Other mutations in Agpat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02228:Agpat1 APN 17 34610562 missense possibly damaging 0.67
R0359:Agpat1 UTSW 17 34610577 missense probably benign 0.27
R7441:Agpat1 UTSW 17 34610909 missense probably damaging 1.00
R8113:Agpat1 UTSW 17 34611612 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAACGGCTGGATCCTCTTC -3'
(R):5'- GCCTGAGGACAGATGACATC -3'

Sequencing Primer
(F):5'- TCTTGACAGAGCCCAAGGG -3'
(R):5'- CCTGAGGACAGATGACATCCAAGAG -3'
Posted On2019-10-07