Mutagenetix > Incidental Mutation

Incidental Mutation 'R7439:Apc'

576860

Institutional Source

Beutler Lab

Gene Symbol

Apc

Ensembl Gene

ENSMUSG00000005871

Gene Name

adenomatosis polyposis coli

Synonyms

CC1, Min

MMRRC Submission

045515-MU

Accession Numbers

Ncbi RefSeq: NM_007462.3; MGI:88039

Essential gene?

Probably essential (E-score: 0.971) question?

Stock #

R7439 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

34220924-34322189 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 34312073 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 674 (I674K)

Ref Sequence

ENSEMBL: ENSMUSP00000078337 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079362] [ENSMUST00000115781] [ENSMUST00000171187]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000079362
AA Change: I674K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000078337
Gene: ENSMUSG00000005871
AA Change: I674K

Domain	Start	End	E-Value	Type
Pfam:APC_N_CC	4	55	6e-32	PFAM
low complexity region	92	109	N/A	INTRINSIC
Pfam:Suppressor_APC	125	205	2e-24	PFAM
low complexity region	211	222	N/A	INTRINSIC
low complexity region	234	247	N/A	INTRINSIC
ARM	338	390	6.14e-5	SMART
ARM	457	508	1.62e-4	SMART
ARM	510	551	8.56e-4	SMART
ARM	554	595	4.45e-2	SMART
ARM	597	642	5.76e1	SMART
ARM	647	687	1.29e-7	SMART
Pfam:Arm_APC_u3	730	1017	5e-170	PFAM
Pfam:APC_15aa	1018	1032	1.1e-8	PFAM
Pfam:APC_u5	1034	1133	7.6e-55	PFAM
Pfam:APC_15aa	1154	1168	1.6e-8	PFAM
Pfam:APC_15aa	1171	1185	1.9e-9	PFAM
low complexity region	1187	1204	N/A	INTRINSIC
Pfam:APC_crr	1255	1279	1.5e-15	PFAM
Pfam:APC_u9	1280	1367	1.9e-34	PFAM
Pfam:APC_crr	1370	1393	2.2e-10	PFAM
low complexity region	1431	1449	N/A	INTRINSIC
Pfam:APC_crr	1485	1509	2.1e-9	PFAM
low complexity region	1532	1548	N/A	INTRINSIC
Pfam:SAMP	1568	1587	2.7e-11	PFAM
Pfam:APC_crr	1635	1659	1.9e-15	PFAM
Pfam:APC_u13	1660	1716	1.3e-31	PFAM
Pfam:SAMP	1717	1736	3.2e-12	PFAM
Pfam:APC_u14	1737	1837	1e-46	PFAM
Pfam:APC_crr	1839	1864	6.8e-15	PFAM
Pfam:APC_u15	1865	1945	1.8e-40	PFAM
Pfam:APC_crr	1947	1971	1.6e-14	PFAM
Pfam:APC_crr	2007	2030	1.8e-14	PFAM
Pfam:SAMP	2033	2052	1.6e-13	PFAM
low complexity region	2112	2146	N/A	INTRINSIC
Pfam:APC_basic	2223	2579	1.5e-110	PFAM
low complexity region	2626	2638	N/A	INTRINSIC
Pfam:EB1_binding	2670	2842	9.3e-89	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000115781
AA Change: I640K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000111447
Gene: ENSMUSG00000005871
AA Change: I640K

Domain	Start	End	E-Value	Type
PDB:1DEB\|B	2	55	1e-27	PDB
low complexity region	92	109	N/A	INTRINSIC
Pfam:Suppressor_APC	124	206	1.5e-31	PFAM
low complexity region	211	222	N/A	INTRINSIC
ARM	304	356	6.14e-5	SMART
ARM	423	474	1.62e-4	SMART
ARM	476	517	8.56e-4	SMART
ARM	520	561	4.45e-2	SMART
ARM	563	608	5.76e1	SMART
ARM	613	653	1.29e-7	SMART
Pfam:Arm	655	695	1.7e-6	PFAM
low complexity region	797	810	N/A	INTRINSIC
low complexity region	880	892	N/A	INTRINSIC
low complexity region	923	935	N/A	INTRINSIC
Pfam:APC_15aa	984	999	3.7e-9	PFAM
Pfam:APC_15aa	1100	1115	8.4e-8	PFAM
Pfam:APC_15aa	1120	1135	9.9e-9	PFAM
Pfam:APC_15aa	1137	1152	1.2e-9	PFAM
low complexity region	1153	1170	N/A	INTRINSIC
Pfam:APC_crr	1220	1245	7.5e-15	PFAM
low complexity region	1320	1331	N/A	INTRINSIC
Pfam:APC_crr	1334	1359	2.8e-11	PFAM
low complexity region	1397	1415	N/A	INTRINSIC
Pfam:APC_crr	1450	1475	2.2e-8	PFAM
low complexity region	1498	1514	N/A	INTRINSIC
Pfam:SAMP	1533	1553	8.4e-12	PFAM
Pfam:APC_crr	1600	1625	3.5e-13	PFAM
Pfam:SAMP	1682	1702	5e-12	PFAM
low complexity region	1732	1744	N/A	INTRINSIC
Pfam:APC_crr	1805	1830	3.1e-12	PFAM
low complexity region	1866	1877	N/A	INTRINSIC
Pfam:APC_crr	1912	1937	3.5e-13	PFAM
Pfam:APC_crr	1971	1996	7.1e-14	PFAM
Pfam:SAMP	1999	2018	4.6e-13	PFAM
low complexity region	2078	2112	N/A	INTRINSIC
Pfam:APC_basic	2189	2545	1.1e-131	PFAM
low complexity region	2592	2604	N/A	INTRINSIC
Pfam:EB1_binding	2636	2808	2.9e-90	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165590

SMART Domains

Protein: ENSMUSP00000128327
Gene: ENSMUSG00000005871

Domain	Start	End	E-Value	Type
PDB:3AU3\|A	2	33	2e-17	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000171187
AA Change: I656K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000127131
Gene: ENSMUSG00000005871
AA Change: I656K

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
low complexity region	23	52	N/A	INTRINSIC
low complexity region	102	119	N/A	INTRINSIC
Pfam:Suppressor_APC	134	216	5.2e-32	PFAM
ARM	320	372	6.14e-5	SMART
ARM	439	490	1.62e-4	SMART
ARM	492	533	8.56e-4	SMART
ARM	536	577	4.45e-2	SMART
ARM	579	624	5.76e1	SMART
ARM	629	669	1.29e-7	SMART
Pfam:Arm	671	711	6.3e-7	PFAM
low complexity region	813	826	N/A	INTRINSIC
low complexity region	896	908	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
Pfam:APC_15aa	1000	1015	1.4e-9	PFAM
Pfam:APC_15aa	1116	1131	3.1e-8	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

Strain: 1856318; 2387050; 1857951; 1857957
Lethality: E8-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most targeted and hypomorphic heterozygous mutants develop intestinal polyps and colorectal cancer, associated with anemia from intestinal bleeding. Homozygotes are embryonic lethal. Homozygotes for a mild alleles survive and have less extreme tumor incidence. [provided by MGI curators]

Allele List at MGI

All alleles(88) : Targeted(25) Gene trapped(62) Chemically induced(1)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530003J23Rik	G	A	10: 117,238,697		probably benign	Het
Acacb	T	C	5: 114,195,642	V542A	possibly damaging	Het
Adprhl1	C	T	8: 13,223,069	V1230I	probably benign	Het
Agpat1	T	A	17: 34,610,909	Y77N	probably damaging	Het
Arpc5	T	C	1: 152,771,436	S97P	probably damaging	Het
Arrdc5	A	G	17: 56,297,931	F119L	probably benign	Het
Asap1	A	G	15: 64,130,256	V402A	probably damaging	Het
Aspg	T	C	12: 112,124,821	V479A	possibly damaging	Het
B3galnt2	G	A	13: 13,994,485	V368M	probably benign	Het
Bcl3	T	C	7: 19,822,611	T23A	probably benign	Het
Bpifb5	A	G	2: 154,228,933	K215E	possibly damaging	Het
Coa4	T	A	7: 100,539,271	C64S	probably damaging	Het
Dcun1d4	T	C	5: 73,491,536		probably null	Het
Dnaaf5	T	G	5: 139,166,113	C506W	probably damaging	Het
Dock3	A	G	9: 107,023,732	Y345H	probably damaging	Het
Dscaml1	A	G	9: 45,710,326	N1024S	possibly damaging	Het
Dsp	T	C	13: 38,176,502		probably null	Het
Dsp	A	G	13: 38,195,449	T2057A	probably benign	Het
Dync1h1	T	G	12: 110,636,453	L2176R	probably damaging	Het
Eif5b	A	C	1: 38,051,637	D1192A	probably benign	Het
Epn2	A	T	11: 61,546,848		probably benign	Het
Exoc1	T	A	5: 76,545,348	N360K	probably benign	Het
Fam135b	A	T	15: 71,463,680	V555E	probably damaging	Het
Fam208a	T	A	14: 27,471,645	V934E	probably damaging	Het
Fmn1	A	T	2: 113,441,611	Q108L	unknown	Het
Gcc2	A	G	10: 58,256,901	T48A	probably benign	Het
Gm438	T	C	4: 144,777,762	D273G	probably damaging	Het
Gm6619	T	G	6: 131,490,391	I73S	possibly damaging	Het
Gm8267	T	A	14: 44,722,940	D116V	probably damaging	Het
Hapln3	T	A	7: 79,117,269	T341S	probably benign	Het
Lamb3	C	A	1: 193,332,166	D544E	possibly damaging	Het
Lhx5	T	A	5: 120,440,284	S390T	probably benign	Het
Lrrc63	A	G	14: 75,126,257	S145P	possibly damaging	Het
Lrriq1	T	C	10: 103,214,519	M791V	probably benign	Het
Lyg2	A	G	1: 37,911,137	Y37H	possibly damaging	Het
Nrbp1	T	A	5: 31,244,956	M172K	probably damaging	Het
Olfr1044	T	A	2: 86,171,010	D269V	probably damaging	Het
Olfr1261	A	G	2: 89,993,839	I149V	probably benign	Het
Olfr168	T	G	16: 19,530,900	S7R	probably benign	Het
Pcyt2	A	T	11: 120,611,383	Y308N	possibly damaging	Het
Peg10	C	CTCA	6: 4,756,453		probably benign	Het
Phf21b	A	G	15: 84,804,903	S141P	probably damaging	Het
Pigh	G	A	12: 79,089,550	P24S	probably benign	Het
Plekhg3	A	G	12: 76,576,485	D834G	probably damaging	Het
Plekhg5	T	A	4: 152,113,935	V860D	probably benign	Het
Pon1	A	G	6: 5,177,399	I170T	probably damaging	Het
Ptpn9	T	A	9: 57,027,433	Y160*	probably null	Het
Ptprj	T	C	2: 90,449,819	K1045R	possibly damaging	Het
Rilpl2	T	A	5: 124,463,788	H196L	probably benign	Het
Rnf112	C	T	11: 61,451,028	V317I	possibly damaging	Het
Rundc3a	G	T	11: 102,400,046		probably null	Het
Sgsm1	T	C	5: 113,274,321	Y489C	probably damaging	Het
Sis	G	A	3: 72,909,041	H1531Y	possibly damaging	Het
Slc26a9	A	G	1: 131,762,818	Y520C	probably damaging	Het
Smc5	A	G	19: 23,242,700	V467A	probably damaging	Het
Spata20	G	A	11: 94,484,041	A245V	probably benign	Het
Steap3	A	C	1: 120,241,518	F350V	probably benign	Het
Sucnr1	A	G	3: 60,086,696	Q215R	probably benign	Het
Supv3l1	G	A	10: 62,430,615	A594V	probably damaging	Het
Swt1	A	T	1: 151,411,064	F226I	probably benign	Het
Taar7f	A	G	10: 24,049,987	T160A	possibly damaging	Het
Tada2a	A	T	11: 84,126,986		probably null	Het
Taok3	C	A	5: 117,250,909	Q460K	probably damaging	Het
Twf2	A	G	9: 106,214,398	E268G	probably damaging	Het
Upf2	A	T	2: 6,018,932	I698F	unknown	Het
Vmn2r35	T	A	7: 7,817,014	N86Y	probably damaging	Het
Vmn2r84	T	C	10: 130,392,113	T85A	possibly damaging	Het
Vps13d	A	G	4: 145,105,856	S2833P		Het
Xrn1	T	C	9: 96,051,629	S1584P	probably benign	Het
Zfp354b	T	C	11: 50,922,397	Y567C	probably damaging	Het
Zfp52	A	T	17: 21,560,870	R327*	probably null	Het

Other mutations in Apc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00507:Apc	APN	18	34316926	missense	probably benign	0.01
IGL00898:Apc	APN	18	34317094	missense	probably damaging	1.00
IGL01111:Apc	APN	18	34315136	missense	possibly damaging	0.95
IGL01347:Apc	APN	18	34317670	missense	probably damaging	1.00
IGL01375:Apc	APN	18	34313654	missense	probably damaging	1.00
IGL01805:Apc	APN	18	34318218	missense	probably benign	0.02
IGL01997:Apc	APN	18	34315423	missense	probably benign	0.00
IGL02033:Apc	APN	18	34310719	missense	probably damaging	1.00
IGL02323:Apc	APN	18	34315810	nonsense	probably null
IGL02373:Apc	APN	18	34316159	missense	probably damaging	1.00
IGL02379:Apc	APN	18	34298745	missense	probably benign	0.45
IGL02456:Apc	APN	18	34313882	nonsense	probably null
IGL02552:Apc	APN	18	34312982	missense	possibly damaging	0.90
IGL02676:Apc	APN	18	34315634	missense	probably damaging	1.00
IGL02756:Apc	APN	18	34314535	missense	probably damaging	1.00
IGL02938:Apc	APN	18	34315228	missense	probably damaging	0.98
IGL02974:Apc	APN	18	34268383	splice site	probably benign
IGL03124:Apc	APN	18	34299985	missense	probably damaging	0.98
IGL03201:Apc	APN	18	34312376	missense	probably damaging	1.00
IGL03339:Apc	APN	18	34298474	missense	probably damaging	1.00
FR4304:Apc	UTSW	18	34281997	intron	probably benign
FR4342:Apc	UTSW	18	34281999	intron	probably benign
FR4449:Apc	UTSW	18	34282000	intron	probably benign
FR4449:Apc	UTSW	18	34282005	intron	probably benign
FR4548:Apc	UTSW	18	34281998	intron	probably benign
FR4737:Apc	UTSW	18	34281999	intron	probably benign
FR4976:Apc	UTSW	18	34281998	intron	probably benign
FR4976:Apc	UTSW	18	34282000	intron	probably benign
FR4976:Apc	UTSW	18	34282004	nonsense	probably null
R0385:Apc	UTSW	18	34315944	missense	probably damaging	1.00
R0535:Apc	UTSW	18	34261072	missense	probably damaging	1.00
R0561:Apc	UTSW	18	34313303	missense	possibly damaging	0.94
R0590:Apc	UTSW	18	34316230	nonsense	probably null
R0626:Apc	UTSW	18	34318454	missense	probably damaging	1.00
R0991:Apc	UTSW	18	34316107	missense	probably damaging	1.00
R1564:Apc	UTSW	18	34315149	missense	probably benign	0.00
R1663:Apc	UTSW	18	34268325	missense	probably damaging	0.98
R1737:Apc	UTSW	18	34317022	missense	probably damaging	1.00
R1739:Apc	UTSW	18	34312318	missense	probably damaging	1.00
R1835:Apc	UTSW	18	34317077	missense	probably damaging	1.00
R1887:Apc	UTSW	18	34272468	missense	probably damaging	1.00
R1957:Apc	UTSW	18	34317335	missense	probably damaging	1.00
R1974:Apc	UTSW	18	34300004	missense	possibly damaging	0.62
R2005:Apc	UTSW	18	34310909	critical splice donor site	probably null
R2013:Apc	UTSW	18	34315591	missense	probably damaging	0.98
R2014:Apc	UTSW	18	34315591	missense	probably damaging	0.98
R2015:Apc	UTSW	18	34315591	missense	probably damaging	0.98
R2017:Apc	UTSW	18	34313602	missense	probably benign	0.00
R2056:Apc	UTSW	18	34316428	missense	probably damaging	1.00
R2108:Apc	UTSW	18	34269229	missense	probably damaging	1.00
R2120:Apc	UTSW	18	34276601	missense	probably damaging	1.00
R2131:Apc	UTSW	18	34312045	missense	possibly damaging	0.51
R2133:Apc	UTSW	18	34312045	missense	possibly damaging	0.51
R2291:Apc	UTSW	18	34312491	missense	probably benign	0.45
R2332:Apc	UTSW	18	34317059	missense	possibly damaging	0.50
R2360:Apc	UTSW	18	34261126	missense	probably damaging	1.00
R2407:Apc	UTSW	18	34314262	missense	possibly damaging	0.77
R2507:Apc	UTSW	18	34316537	missense	possibly damaging	0.77
R2940:Apc	UTSW	18	34276670	missense	probably damaging	1.00
R3404:Apc	UTSW	18	34313602	missense	probably benign	0.00
R3411:Apc	UTSW	18	34269259	splice site	probably benign
R3778:Apc	UTSW	18	34313081	missense	probably damaging	1.00
R3826:Apc	UTSW	18	34279335	missense	possibly damaging	0.93
R4599:Apc	UTSW	18	34317987	nonsense	probably null
R4611:Apc	UTSW	18	34318565	missense	probably damaging	1.00
R4664:Apc	UTSW	18	34298594	missense	probably damaging	0.98
R4969:Apc	UTSW	18	34312918	nonsense	probably null
R5007:Apc	UTSW	18	34312963	missense	probably damaging	1.00
R5066:Apc	UTSW	18	34316105	missense	probably damaging	1.00
R5112:Apc	UTSW	18	34316109	nonsense	probably null
R5259:Apc	UTSW	18	34314290	missense	probably benign	0.29
R5440:Apc	UTSW	18	34221160	unclassified	probably benign
R5508:Apc	UTSW	18	34298580	missense	probably damaging	0.97
R5512:Apc	UTSW	18	34310909	critical splice donor site	probably benign
R5850:Apc	UTSW	18	34318063	missense	possibly damaging	0.94
R5951:Apc	UTSW	18	34317146	missense	possibly damaging	0.89
R5966:Apc	UTSW	18	34221087	utr 5 prime	probably benign
R6081:Apc	UTSW	18	34290111	missense	possibly damaging	0.93
R6116:Apc	UTSW	18	34316455	missense	probably damaging	1.00
R6351:Apc	UTSW	18	34312212	missense	probably damaging	1.00
R6354:Apc	UTSW	18	34312528	missense	probably benign	0.02
R6467:Apc	UTSW	18	34269199	missense	probably benign	0.22
R6974:Apc	UTSW	18	34298427	missense	possibly damaging	0.65
R7027:Apc	UTSW	18	34312076	missense	probably damaging	1.00
R7096:Apc	UTSW	18	34315957	missense	probably damaging	1.00
R7289:Apc	UTSW	18	34315271	missense	probably damaging	1.00
R7441:Apc	UTSW	18	34312073	missense	probably damaging	1.00
R7534:Apc	UTSW	18	34316962	missense	probably damaging	1.00
R7685:Apc	UTSW	18	34314208	missense	probably damaging	1.00
R7814:Apc	UTSW	18	34272539	missense	probably damaging	0.98
R7954:Apc	UTSW	18	34314268	missense	probably damaging	0.99
R8352:Apc	UTSW	18	34312751	missense	possibly damaging	0.54
R8452:Apc	UTSW	18	34312751	missense	possibly damaging	0.54
R8497:Apc	UTSW	18	34313030	missense	possibly damaging	0.81
R8545:Apc	UTSW	18	34317031	missense	possibly damaging	0.94
R8554:Apc	UTSW	18	34312946	missense	probably damaging	1.00
R8955:Apc	UTSW	18	34268317	missense	probably damaging	1.00
R9014:Apc	UTSW	18	34221021	start gained	probably benign
R9061:Apc	UTSW	18	34313198	missense	probably damaging	1.00
R9147:Apc	UTSW	18	34317657	missense	probably damaging	1.00
R9318:Apc	UTSW	18	34313987	missense	possibly damaging	0.69
R9521:Apc	UTSW	18	34312685	missense	probably benign	0.24
R9546:Apc	UTSW	18	34312258	missense	possibly damaging	0.86
R9547:Apc	UTSW	18	34312258	missense	possibly damaging	0.86
R9557:Apc	UTSW	18	34318359	missense	probably damaging	1.00
R9592:Apc	UTSW	18	34310770	nonsense	probably null
R9675:Apc	UTSW	18	34316194	missense	probably damaging	1.00
R9736:Apc	UTSW	18	34317770	missense	probably damaging	1.00
R9792:Apc	UTSW	18	34314575	missense	probably damaging	1.00
R9793:Apc	UTSW	18	34314575	missense	probably damaging	1.00
R9795:Apc	UTSW	18	34314575	missense	probably damaging	1.00
RF046:Apc	UTSW	18	34282009	critical splice donor site	probably benign
RF063:Apc	UTSW	18	34282009	critical splice donor site	probably benign
X0021:Apc	UTSW	18	34312108	missense	probably damaging	1.00
X0025:Apc	UTSW	18	34312376	missense	probably damaging	1.00
Z1088:Apc	UTSW	18	34313167	nonsense	probably null
Z1177:Apc	UTSW	18	34314463	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- CATTGACTGGACCAAGAGAGC -3'
(R):5'- GGTCTGTTTGCCATGAGATTCC -3'

Sequencing Primer
(F):5'- AGATGGCTGATGTGCTCATAAC -3'
(R):5'- GCCATGAGATTCCTTAAAGCTGCTG -3'

Posted On

2019-10-07