Incidental Mutation 'R7440:Cep350'
ID576866
Institutional Source Beutler Lab
Gene Symbol Cep350
Ensembl Gene ENSMUSG00000033671
Gene Namecentrosomal protein 350
Synonyms6430546F08Rik, 4933409L06Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001039184.1; Ensembl: ENSMUST00000138762, ENSMUST00000124495, ENSMUST00000078888

Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R7440 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location155844964-155973255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 155940772 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 332 (K332N)
Ref Sequence ENSEMBL: ENSMUSP00000121043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124495] [ENSMUST00000138762]
Predicted Effect probably damaging
Transcript: ENSMUST00000124495
AA Change: K332N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000138762
AA Change: K392N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120085
Gene: ENSMUSG00000033671
AA Change: K392N

DomainStartEndE-ValueType
low complexity region 251 265 N/A INTRINSIC
low complexity region 376 394 N/A INTRINSIC
low complexity region 481 491 N/A INTRINSIC
coiled coil region 596 641 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 701 719 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 979 994 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1250 1267 N/A INTRINSIC
coiled coil region 1363 1402 N/A INTRINSIC
low complexity region 1517 1531 N/A INTRINSIC
low complexity region 1536 1546 N/A INTRINSIC
low complexity region 1694 1714 N/A INTRINSIC
coiled coil region 1732 1794 N/A INTRINSIC
low complexity region 1800 1811 N/A INTRINSIC
low complexity region 1819 1835 N/A INTRINSIC
coiled coil region 1853 1893 N/A INTRINSIC
low complexity region 1980 1994 N/A INTRINSIC
coiled coil region 2042 2092 N/A INTRINSIC
low complexity region 2383 2394 N/A INTRINSIC
low complexity region 2409 2421 N/A INTRINSIC
low complexity region 2470 2482 N/A INTRINSIC
CAP_GLY 2486 2551 5.91e-31 SMART
coiled coil region 2700 2731 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a large protein with a CAP-Gly domain typically found in cytoskeleton-associated proteins. The encoded protein primarily localizes to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. The encoded protein directly interacts with another large centrosomal protein and is required to anchor microtubules at the centrosome. It is also implicated in the regulation of a class of nuclear hormone receptors in the nucleus. Several alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI

 All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik A G 9: 50,764,913 V35A probably benign Het
9230104L09Rik A C 2: 148,846,991 C109W probably damaging Het
Acadm G A 3: 153,922,989 T403I probably damaging Het
Adat1 A T 8: 111,989,898 M64K probably damaging Het
Adcy2 C T 13: 68,796,667 V199M probably damaging Het
Ankrd13a T C 5: 114,803,575 S508P possibly damaging Het
Ap1g1 T A 8: 109,802,724 probably null Het
Bicral C T 17: 46,825,784 G167R probably damaging Het
Ccser2 T C 14: 36,898,217 K727E possibly damaging Het
Chd5 A G 4: 152,384,651 N1811S probably benign Het
Chpf A T 1: 75,475,601 V565D probably damaging Het
Clcn6 A T 4: 148,014,195 L489H probably damaging Het
Cntln C A 4: 85,063,216 T877K possibly damaging Het
Cog4 T C 8: 110,879,706 V630A probably benign Het
Col6a5 G T 9: 105,881,431 S2192* probably null Het
Cry2 G A 2: 92,413,638 R397W probably damaging Het
Cyp1b1 T C 17: 79,713,557 N252S probably damaging Het
Dhx9 T C 1: 153,481,231 I91V probably benign Het
Dnajb6 G A 5: 29,757,859 A256T possibly damaging Het
Epm2a T G 10: 11,390,875 Y121* probably null Het
Erlec1 T C 11: 30,950,818 I117V possibly damaging Het
Exoc8 T C 8: 124,895,781 M616V probably benign Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Fuz T C 7: 44,896,572 L46P probably damaging Het
Gm15319 C T 8: 20,356,948 S254N unknown Het
Insc T C 7: 114,845,043 S422P possibly damaging Het
Intu A G 3: 40,697,551 I813V probably benign Het
Jak3 T A 8: 71,680,718 S352T probably benign Het
Klf11 T C 12: 24,655,491 S315P probably benign Het
Lrrc63 T C 14: 75,121,013 N400D possibly damaging Het
Lrrk1 T C 7: 66,290,854 D760G probably damaging Het
Macf1 A T 4: 123,455,446 L3976* probably null Het
Map7 C T 10: 20,261,859 A259V probably damaging Het
Meioc T A 11: 102,674,237 D170E possibly damaging Het
Mgat5b T A 11: 116,968,445 Y34* probably null Het
Mgst1 A G 6: 138,150,844 K68R probably benign Het
Miga1 T A 3: 152,338,046 probably null Het
Mrps33 G A 6: 39,802,479 P94L probably damaging Het
Ncapg2 G T 12: 116,450,413 G1068C possibly damaging Het
Ndufaf7 C T 17: 78,942,117 H148Y probably damaging Het
Nkx6-3 A T 8: 23,153,754 D57V probably damaging Het
Nlrp1a T C 11: 71,092,324 D1272G probably damaging Het
Oit3 T C 10: 59,429,570 N291S probably damaging Het
Olfr362 A T 2: 37,105,169 H160Q possibly damaging Het
Pld1 T G 3: 28,041,270 S251A probably benign Het
Ppfibp1 T C 6: 147,019,503 S580P probably benign Het
Prdx6b A T 2: 80,293,216 D123V probably damaging Het
Ptprs A G 17: 56,424,256 L1050P possibly damaging Het
Rcc1 A C 4: 132,337,799 S138A probably damaging Het
Rimbp3 G T 16: 17,213,201 R1496S possibly damaging Het
Sacs T C 14: 61,191,605 V371A probably benign Het
Sfxn4 A G 19: 60,842,204 L260P possibly damaging Het
Slc17a1 G A 13: 23,878,483 S211N possibly damaging Het
Slc39a11 C T 11: 113,562,092 V8M probably damaging Het
Smpd2 A G 10: 41,489,016 I78T probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Syt17 A T 7: 118,381,884 V462E probably damaging Het
Tlr11 T A 14: 50,361,344 D262E probably benign Het
Tnfrsf9 T C 4: 150,929,874 V10A probably benign Het
Trpv3 C A 11: 73,277,974 Q87K probably benign Het
Ugt1a5 T C 1: 88,166,559 Y170H probably benign Het
Urb1 A G 16: 90,787,408 L562P probably damaging Het
Usp3 G T 9: 66,530,255 N299K probably benign Het
Vmn1r83 T C 7: 12,321,629 Y167C probably damaging Het
Vmn2r117 T A 17: 23,475,565 Y436F probably benign Het
Vps13d A G 4: 145,128,411 I2220T Het
Zfp936 T A 7: 43,187,261 V32D probably damaging Het
Znrd1 T A 17: 36,957,844 L75F probably benign Het
Zswim2 A G 2: 83,920,719 C259R probably damaging Het
Other mutations in Cep350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Cep350 APN 1 155940746 missense possibly damaging 0.68
IGL00821:Cep350 APN 1 155862204 missense probably benign
IGL00837:Cep350 APN 1 155953391 missense probably damaging 1.00
IGL00977:Cep350 APN 1 155932865 missense probably null 0.99
IGL01544:Cep350 APN 1 155953187 missense probably damaging 1.00
IGL01616:Cep350 APN 1 155953247 missense probably benign 0.00
IGL01695:Cep350 APN 1 155944158 missense probably damaging 1.00
IGL01902:Cep350 APN 1 155861985 missense probably damaging 1.00
IGL01977:Cep350 APN 1 155911968 missense probably benign 0.01
IGL02388:Cep350 APN 1 155953753 missense probably benign 0.28
IGL02475:Cep350 APN 1 155862595 missense probably damaging 1.00
IGL02528:Cep350 APN 1 155894615 missense probably damaging 1.00
IGL02598:Cep350 APN 1 155862967 missense probably benign 0.00
IGL02676:Cep350 APN 1 155862231 missense possibly damaging 0.82
IGL02728:Cep350 APN 1 155953222 missense probably benign 0.02
IGL02744:Cep350 APN 1 155931533 missense probably damaging 0.98
IGL02817:Cep350 APN 1 155928842 missense probably damaging 1.00
IGL02892:Cep350 APN 1 155868806 missense possibly damaging 0.51
IGL03156:Cep350 APN 1 155858042 missense probably damaging 1.00
IGL03166:Cep350 APN 1 155863600 missense possibly damaging 0.78
IGL03216:Cep350 APN 1 155860627 missense probably benign 0.06
IGL03268:Cep350 APN 1 155953549 missense probably benign 0.16
IGL03358:Cep350 APN 1 155928539 missense probably benign
primed UTSW 1 155953588 missense probably damaging 0.98
stoked UTSW 1 155915575 missense probably benign 0.03
NA:Cep350 UTSW 1 155958648 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0172:Cep350 UTSW 1 155953447 missense probably benign 0.00
R0365:Cep350 UTSW 1 155906571 missense probably benign 0.00
R0472:Cep350 UTSW 1 155914723 missense probably damaging 0.99
R0502:Cep350 UTSW 1 155900883 splice site probably null
R0538:Cep350 UTSW 1 155848620 missense possibly damaging 0.80
R0547:Cep350 UTSW 1 155901435 splice site probably null
R0565:Cep350 UTSW 1 155961195 splice site probably benign
R0607:Cep350 UTSW 1 155872048 missense probably damaging 1.00
R0645:Cep350 UTSW 1 155940712 splice site probably null
R0675:Cep350 UTSW 1 155959753 missense possibly damaging 0.63
R0828:Cep350 UTSW 1 155953246 missense probably benign 0.00
R0863:Cep350 UTSW 1 155862235 missense probably benign 0.00
R0969:Cep350 UTSW 1 155940826 missense possibly damaging 0.81
R1102:Cep350 UTSW 1 155931518 missense probably damaging 1.00
R1186:Cep350 UTSW 1 155875376 missense probably damaging 1.00
R1552:Cep350 UTSW 1 155910738 missense possibly damaging 0.92
R1560:Cep350 UTSW 1 155929079 missense possibly damaging 0.48
R1698:Cep350 UTSW 1 155953358 missense possibly damaging 0.62
R1729:Cep350 UTSW 1 155911981 missense probably benign 0.17
R1735:Cep350 UTSW 1 155953214 missense probably damaging 0.99
R1740:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R1783:Cep350 UTSW 1 155928865 missense probably damaging 1.00
R1844:Cep350 UTSW 1 155848628 missense probably damaging 0.99
R1848:Cep350 UTSW 1 155953651 missense probably benign 0.28
R1988:Cep350 UTSW 1 155933104 missense possibly damaging 0.82
R2008:Cep350 UTSW 1 155914721 missense probably benign 0.16
R2241:Cep350 UTSW 1 155958556 splice site probably null
R2245:Cep350 UTSW 1 155879020 missense probably benign 0.10
R2402:Cep350 UTSW 1 155863136 missense probably benign
R2566:Cep350 UTSW 1 155959718 critical splice donor site probably null
R3160:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3162:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3769:Cep350 UTSW 1 155953204 missense probably damaging 1.00
R4035:Cep350 UTSW 1 155959795 missense probably benign 0.06
R4158:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4160:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4213:Cep350 UTSW 1 155935961 missense probably damaging 1.00
R4483:Cep350 UTSW 1 155926468 missense probably benign 0.01
R4648:Cep350 UTSW 1 155902598 missense possibly damaging 0.85
R4694:Cep350 UTSW 1 155928586 missense probably damaging 1.00
R4836:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R4839:Cep350 UTSW 1 155928494 missense probably benign 0.00
R4969:Cep350 UTSW 1 155860279 missense probably damaging 0.99
R5014:Cep350 UTSW 1 155928206 missense probably benign 0.00
R5027:Cep350 UTSW 1 155933354 missense probably benign 0.01
R5144:Cep350 UTSW 1 155911150 missense probably damaging 0.99
R5153:Cep350 UTSW 1 155935946 missense probably damaging 1.00
R5165:Cep350 UTSW 1 155928368 missense probably damaging 1.00
R5182:Cep350 UTSW 1 155858108 missense probably damaging 1.00
R5445:Cep350 UTSW 1 155894723 missense probably benign 0.01
R5738:Cep350 UTSW 1 155866078 missense probably damaging 1.00
R5809:Cep350 UTSW 1 155933341 missense probably damaging 0.98
R5855:Cep350 UTSW 1 155953762 missense probably benign 0.00
R6103:Cep350 UTSW 1 155924576 missense probably benign 0.05
R6139:Cep350 UTSW 1 155953279 missense probably benign 0.03
R6285:Cep350 UTSW 1 155953374 missense possibly damaging 0.48
R6430:Cep350 UTSW 1 155894673 missense probably damaging 1.00
R6446:Cep350 UTSW 1 155862154 missense probably benign
R6520:Cep350 UTSW 1 155933336 missense probably benign 0.02
R6712:Cep350 UTSW 1 155858106 missense possibly damaging 0.93
R6940:Cep350 UTSW 1 155928551 missense probably benign 0.01
R7020:Cep350 UTSW 1 155928331 missense probably damaging 1.00
R7056:Cep350 UTSW 1 155848627 missense probably damaging 1.00
R7141:Cep350 UTSW 1 155914748 missense probably damaging 1.00
R7215:Cep350 UTSW 1 155894707 missense possibly damaging 0.89
R7247:Cep350 UTSW 1 155910753 missense probably damaging 1.00
R7272:Cep350 UTSW 1 155953588 missense probably damaging 0.98
R7336:Cep350 UTSW 1 155862276 missense probably benign 0.17
R7361:Cep350 UTSW 1 155901491 missense probably damaging 1.00
R7390:Cep350 UTSW 1 155866087 missense possibly damaging 0.94
R7402:Cep350 UTSW 1 155928215 missense probably benign 0.00
R7428:Cep350 UTSW 1 155894619 missense probably benign 0.00
R7520:Cep350 UTSW 1 155915629 missense probably benign 0.05
R7529:Cep350 UTSW 1 155861923 missense probably benign 0.08
R7635:Cep350 UTSW 1 155879021 nonsense probably null
R7806:Cep350 UTSW 1 155862063 missense probably benign 0.00
R8100:Cep350 UTSW 1 155953402 missense probably damaging 0.97
R8192:Cep350 UTSW 1 155940783 missense possibly damaging 0.94
R8193:Cep350 UTSW 1 155862079 missense probably benign 0.01
R8351:Cep350 UTSW 1 155872034 missense probably damaging 0.99
R8406:Cep350 UTSW 1 155922418 missense probably benign 0.00
R8451:Cep350 UTSW 1 155872034 missense probably damaging 0.99
R8467:Cep350 UTSW 1 155915575 missense probably benign 0.03
R8543:Cep350 UTSW 1 155862376 missense probably damaging 0.98
R8714:Cep350 UTSW 1 155860731 missense probably damaging 0.98
R8810:Cep350 UTSW 1 155928116 missense probably damaging 1.00
R8837:Cep350 UTSW 1 155861772 missense probably benign 0.09
R8933:Cep350 UTSW 1 155863415 missense probably benign 0.01
RF020:Cep350 UTSW 1 155915478 missense probably benign 0.34
X0018:Cep350 UTSW 1 155953286 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ACAGTTAATGCTGTCAACTATACCT -3'
(R):5'- ATTGCAGTTGACCTTGGGTA -3'

Sequencing Primer
(F):5'- GCATACAGATTCCACTTCTA -3'
(R):5'- TAACCGAAGCTGCAGAAATAGGGTAC -3'
Posted On2019-10-07