Incidental Mutation 'R7440:Fmn1'
ID576871
Institutional Source Beutler Lab
Gene Symbol Fmn1
Ensembl Gene ENSMUSG00000044042
Gene Nameformin 1
SynonymsFmn, formin-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.321) question?
Stock #R7440 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location113327736-113716767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 113441611 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 108 (Q108L)
Ref Sequence ENSEMBL: ENSMUSP00000080093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081349] [ENSMUST00000099576] [ENSMUST00000102547] [ENSMUST00000161731]
PDB Structure
FBP28WW2 domain in complex with the PPLIPPPP peptide [SOLUTION NMR]
FBP28WW2 domain in complex with PTPPPLPP peptide [SOLUTION NMR]
FBP28WW2 domain in complex with a PPPLIPPPP peptide [SOLUTION NMR]
Predicted Effect unknown
Transcript: ENSMUST00000081349
AA Change: Q108L
SMART Domains Protein: ENSMUSP00000080093
Gene: ENSMUSG00000044042
AA Change: Q108L

DomainStartEndE-ValueType
Blast:FH2 25 641 N/A BLAST
SCOP:d1jvr__ 668 699 2e-3 SMART
FH2 757 1162 1.16e-137 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099576
SMART Domains Protein: ENSMUSP00000097171
Gene: ENSMUSG00000044042

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1388 1.16e-137 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102547
SMART Domains Protein: ENSMUSP00000099606
Gene: ENSMUSG00000044042

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1424 1.03e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161731
SMART Domains Protein: ENSMUSP00000125052
Gene: ENSMUSG00000044042

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 619 1e-62 BLAST
Blast:FH2 625 765 3e-53 BLAST
SCOP:d1jvr__ 796 827 2e-3 SMART
FH2 885 1290 1.16e-137 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the formin homology family and encodes a protein that has a role in the formation of adherens junction and the polymerization of linear actin cables. The homologous gene in mouse is associated with limb deformity. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous, irradiation-induced, and transgene-insertional mutations show severe syndactyly and oligodactyly of the feet, abnormal long bones (including radius-ulna fusions), and reduced or absent kidneys. Many mutants survive and breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik A G 9: 50,764,913 V35A probably benign Het
9230104L09Rik A C 2: 148,846,991 C109W probably damaging Het
Acadm G A 3: 153,922,989 T403I probably damaging Het
Adat1 A T 8: 111,989,898 M64K probably damaging Het
Adcy2 C T 13: 68,796,667 V199M probably damaging Het
Ankrd13a T C 5: 114,803,575 S508P possibly damaging Het
Ap1g1 T A 8: 109,802,724 probably null Het
Bicral C T 17: 46,825,784 G167R probably damaging Het
Ccser2 T C 14: 36,898,217 K727E possibly damaging Het
Cep350 T G 1: 155,940,772 K332N probably damaging Het
Chd5 A G 4: 152,384,651 N1811S probably benign Het
Chpf A T 1: 75,475,601 V565D probably damaging Het
Clcn6 A T 4: 148,014,195 L489H probably damaging Het
Cntln C A 4: 85,063,216 T877K possibly damaging Het
Cog4 T C 8: 110,879,706 V630A probably benign Het
Col6a5 G T 9: 105,881,431 S2192* probably null Het
Cry2 G A 2: 92,413,638 R397W probably damaging Het
Cyp1b1 T C 17: 79,713,557 N252S probably damaging Het
Dhx9 T C 1: 153,481,231 I91V probably benign Het
Dnajb6 G A 5: 29,757,859 A256T possibly damaging Het
Epm2a T G 10: 11,390,875 Y121* probably null Het
Erlec1 T C 11: 30,950,818 I117V possibly damaging Het
Exoc8 T C 8: 124,895,781 M616V probably benign Het
Fuz T C 7: 44,896,572 L46P probably damaging Het
Gm15319 C T 8: 20,356,948 S254N unknown Het
Insc T C 7: 114,845,043 S422P possibly damaging Het
Intu A G 3: 40,697,551 I813V probably benign Het
Jak3 T A 8: 71,680,718 S352T probably benign Het
Klf11 T C 12: 24,655,491 S315P probably benign Het
Lrrc63 T C 14: 75,121,013 N400D possibly damaging Het
Lrrk1 T C 7: 66,290,854 D760G probably damaging Het
Macf1 A T 4: 123,455,446 L3976* probably null Het
Map7 C T 10: 20,261,859 A259V probably damaging Het
Meioc T A 11: 102,674,237 D170E possibly damaging Het
Mgat5b T A 11: 116,968,445 Y34* probably null Het
Mgst1 A G 6: 138,150,844 K68R probably benign Het
Miga1 T A 3: 152,338,046 probably null Het
Mrps33 G A 6: 39,802,479 P94L probably damaging Het
Ncapg2 G T 12: 116,450,413 G1068C possibly damaging Het
Ndufaf7 C T 17: 78,942,117 H148Y probably damaging Het
Nkx6-3 A T 8: 23,153,754 D57V probably damaging Het
Nlrp1a T C 11: 71,092,324 D1272G probably damaging Het
Oit3 T C 10: 59,429,570 N291S probably damaging Het
Olfr362 A T 2: 37,105,169 H160Q possibly damaging Het
Pld1 T G 3: 28,041,270 S251A probably benign Het
Ppfibp1 T C 6: 147,019,503 S580P probably benign Het
Prdx6b A T 2: 80,293,216 D123V probably damaging Het
Ptprs A G 17: 56,424,256 L1050P possibly damaging Het
Rcc1 A C 4: 132,337,799 S138A probably damaging Het
Rimbp3 G T 16: 17,213,201 R1496S possibly damaging Het
Sacs T C 14: 61,191,605 V371A probably benign Het
Sfxn4 A G 19: 60,842,204 L260P possibly damaging Het
Slc17a1 G A 13: 23,878,483 S211N possibly damaging Het
Slc39a11 C T 11: 113,562,092 V8M probably damaging Het
Smpd2 A G 10: 41,489,016 I78T probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Syt17 A T 7: 118,381,884 V462E probably damaging Het
Tlr11 T A 14: 50,361,344 D262E probably benign Het
Tnfrsf9 T C 4: 150,929,874 V10A probably benign Het
Trpv3 C A 11: 73,277,974 Q87K probably benign Het
Ugt1a5 T C 1: 88,166,559 Y170H probably benign Het
Urb1 A G 16: 90,787,408 L562P probably damaging Het
Usp3 G T 9: 66,530,255 N299K probably benign Het
Vmn1r83 T C 7: 12,321,629 Y167C probably damaging Het
Vmn2r117 T A 17: 23,475,565 Y436F probably benign Het
Vps13d A G 4: 145,128,411 I2220T Het
Zfp936 T A 7: 43,187,261 V32D probably damaging Het
Znrd1 T A 17: 36,957,844 L75F probably benign Het
Zswim2 A G 2: 83,920,719 C259R probably damaging Het
Other mutations in Fmn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Fmn1 APN 2 113444467 intron probably benign
IGL01520:Fmn1 APN 2 113444368 intron probably benign
IGL02039:Fmn1 APN 2 113365080 missense unknown
IGL02222:Fmn1 APN 2 113593109 missense probably damaging 1.00
IGL02238:Fmn1 APN 2 113582125 missense possibly damaging 0.90
IGL02373:Fmn1 APN 2 113364126 missense unknown
IGL02490:Fmn1 APN 2 113529472 splice site probably benign
IGL02506:Fmn1 APN 2 113525295 missense unknown
IGL02684:Fmn1 APN 2 113525277 missense unknown
IGL03008:Fmn1 APN 2 113365100 missense unknown
IGL03058:Fmn1 APN 2 113441814 intron probably benign
IGL03076:Fmn1 APN 2 113584092 missense probably damaging 0.99
FR4304:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4304:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4342:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525773 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525778 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525781 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525784 small insertion probably benign
R0349:Fmn1 UTSW 2 113365796 missense unknown
R0452:Fmn1 UTSW 2 113636779 missense possibly damaging 0.46
R0529:Fmn1 UTSW 2 113707853 splice site probably benign
R1215:Fmn1 UTSW 2 113693030 nonsense probably null
R1471:Fmn1 UTSW 2 113693094 missense possibly damaging 0.95
R1489:Fmn1 UTSW 2 113365212 missense unknown
R1491:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R1551:Fmn1 UTSW 2 113525862 missense possibly damaging 0.70
R1558:Fmn1 UTSW 2 113693118 missense possibly damaging 0.46
R1588:Fmn1 UTSW 2 113365698 missense unknown
R1602:Fmn1 UTSW 2 113525623 missense unknown
R1690:Fmn1 UTSW 2 113525482 missense unknown
R1772:Fmn1 UTSW 2 113365355 missense unknown
R1867:Fmn1 UTSW 2 113709438 missense probably damaging 1.00
R1923:Fmn1 UTSW 2 113429721 intron probably benign
R1941:Fmn1 UTSW 2 113365143 missense unknown
R2019:Fmn1 UTSW 2 113364480 missense unknown
R2140:Fmn1 UTSW 2 113595048 missense probably benign 0.45
R2164:Fmn1 UTSW 2 113365617 missense unknown
R2395:Fmn1 UTSW 2 113365181 missense unknown
R2999:Fmn1 UTSW 2 113365094 missense unknown
R3405:Fmn1 UTSW 2 113364348 missense unknown
R3407:Fmn1 UTSW 2 113365055 missense unknown
R3771:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3772:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3773:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3777:Fmn1 UTSW 2 113365122 missense unknown
R4166:Fmn1 UTSW 2 113636735 missense probably benign 0.33
R4477:Fmn1 UTSW 2 113444399 intron probably benign
R4614:Fmn1 UTSW 2 113365149 missense unknown
R4701:Fmn1 UTSW 2 113584071 missense possibly damaging 0.76
R4867:Fmn1 UTSW 2 113584120 critical splice donor site probably null
R5063:Fmn1 UTSW 2 113364921 missense unknown
R5224:Fmn1 UTSW 2 113365125 missense unknown
R5510:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R6083:Fmn1 UTSW 2 113364303 missense unknown
R6234:Fmn1 UTSW 2 113365655 missense unknown
R6266:Fmn1 UTSW 2 113596338 missense probably damaging 1.00
R6764:Fmn1 UTSW 2 113525215 missense unknown
R7054:Fmn1 UTSW 2 113365008 missense unknown
R7311:Fmn1 UTSW 2 113525680 missense unknown
R7439:Fmn1 UTSW 2 113441611 missense unknown
R7441:Fmn1 UTSW 2 113441611 missense unknown
R7444:Fmn1 UTSW 2 113441611 missense unknown
R7461:Fmn1 UTSW 2 113364071 missense unknown
R7526:Fmn1 UTSW 2 113688134 missense probably damaging 0.99
R7540:Fmn1 UTSW 2 113529310 splice site probably null
R7576:Fmn1 UTSW 2 113365008 missense unknown
R7657:Fmn1 UTSW 2 113525193 missense unknown
R7669:Fmn1 UTSW 2 113365477 missense unknown
R7713:Fmn1 UTSW 2 113525814 missense unknown
R7841:Fmn1 UTSW 2 113529465 critical splice donor site probably null
R7924:Fmn1 UTSW 2 113529465 critical splice donor site probably null
R8041:Fmn1 UTSW 2 113364594 missense unknown
RF003:Fmn1 UTSW 2 113525786 small insertion probably benign
Z1088:Fmn1 UTSW 2 113441925 intron probably benign
Predicted Primers PCR Primer
(F):5'- ACTCCTTGGAGCCTGAAGAG -3'
(R):5'- GGGCTCTTGAGAAGGTTCAC -3'

Sequencing Primer
(F):5'- CCTGAAGAGGAAGATGCTGTGC -3'
(R):5'- GGCTCTTGAGAAGGTTCACATAAAAC -3'
Posted On2019-10-07