Incidental Mutation 'R7440:Pld1'
ID576873
Institutional Source Beutler Lab
Gene Symbol Pld1
Ensembl Gene ENSMUSG00000027695
Gene Namephospholipase D1
SynonymsPld1a, Pld1b
Accession Numbers

Genbank: NM_001164056; MGI: 109585

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7440 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location27938695-28133362 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 28041270 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 251 (S251A)
Ref Sequence ENSEMBL: ENSMUSP00000113810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067757] [ENSMUST00000120834] [ENSMUST00000123539]
Predicted Effect probably benign
Transcript: ENSMUST00000067757
AA Change: S251A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000064694
Gene: ENSMUSG00000027695
AA Change: S251A

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
PLDc 853 880 1.34e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120834
AA Change: S251A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113810
Gene: ENSMUSG00000027695
AA Change: S251A

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
PLDc 853 880 1.34e-6 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000118727
Gene: ENSMUSG00000027695
AA Change: S251A

DomainStartEndE-ValueType
PX 79 209 7.97e-25 SMART
PH 220 330 5.71e-9 SMART
PLDc 459 486 6.6e-6 SMART
low complexity region 503 517 N/A INTRINSIC
low complexity region 575 586 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000120273
Gene: ENSMUSG00000027695
AA Change: S62A

DomainStartEndE-ValueType
PH 32 142 5.71e-9 SMART
PLDc 271 298 6.6e-6 SMART
low complexity region 315 329 N/A INTRINSIC
low complexity region 387 401 N/A INTRINSIC
PLDc 665 715 2.5e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylcholine-specific phospholipase which catalyzes the hydrolysis of phosphatidylcholine in order to yield phosphatidic acid and choline. The enzyme may play a role in signal transduction and subcellular trafficking. Alternative splicing results in multiple transcript variants with both catalytic and regulatory properties. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a null allele show reduced tumor growth and angiogenesis. Homozygotes for a second null allele show abnormal hepatic autophagy after food restriction. Homozygotes for a third null allele show altered platelet activation and protection from thrombosis and ischemic brain injury. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik A G 9: 50,764,913 V35A probably benign Het
9230104L09Rik A C 2: 148,846,991 C109W probably damaging Het
Acadm G A 3: 153,922,989 T403I probably damaging Het
Adat1 A T 8: 111,989,898 M64K probably damaging Het
Adcy2 C T 13: 68,796,667 V199M probably damaging Het
Ankrd13a T C 5: 114,803,575 S508P possibly damaging Het
Bicral C T 17: 46,825,784 G167R probably damaging Het
Ccser2 T C 14: 36,898,217 K727E possibly damaging Het
Cep350 T G 1: 155,940,772 K332N probably damaging Het
Chd5 A G 4: 152,384,651 N1811S probably benign Het
Chpf A T 1: 75,475,601 V565D probably damaging Het
Clcn6 A T 4: 148,014,195 L489H probably damaging Het
Cntln C A 4: 85,063,216 T877K possibly damaging Het
Cog4 T C 8: 110,879,706 V630A probably benign Het
Col6a5 G T 9: 105,881,431 S2192* probably null Het
Cry2 G A 2: 92,413,638 R397W probably damaging Het
Cyp1b1 T C 17: 79,713,557 N252S probably damaging Het
Dhx9 T C 1: 153,481,231 I91V probably benign Het
Dnajb6 G A 5: 29,757,859 A256T possibly damaging Het
Epm2a T G 10: 11,390,875 Y121* probably null Het
Erlec1 T C 11: 30,950,818 I117V possibly damaging Het
Exoc8 T C 8: 124,895,781 M616V probably benign Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Fuz T C 7: 44,896,572 L46P probably damaging Het
Gm15319 C T 8: 20,356,948 S254N unknown Het
Insc T C 7: 114,845,043 S422P possibly damaging Het
Intu A G 3: 40,697,551 I813V probably benign Het
Jak3 T A 8: 71,680,718 S352T probably benign Het
Klf11 T C 12: 24,655,491 S315P probably benign Het
Lrrc63 T C 14: 75,121,013 N400D possibly damaging Het
Lrrk1 T C 7: 66,290,854 D760G probably damaging Het
Macf1 A T 4: 123,455,446 L3976* probably null Het
Map7 C T 10: 20,261,859 A259V probably damaging Het
Meioc T A 11: 102,674,237 D170E possibly damaging Het
Mgat5b T A 11: 116,968,445 Y34* probably null Het
Mgst1 A G 6: 138,150,844 K68R probably benign Het
Mrps33 G A 6: 39,802,479 P94L probably damaging Het
Ncapg2 G T 12: 116,450,413 G1068C possibly damaging Het
Ndufaf7 C T 17: 78,942,117 H148Y probably damaging Het
Nkx6-3 A T 8: 23,153,754 D57V probably damaging Het
Nlrp1a T C 11: 71,092,324 D1272G probably damaging Het
Oit3 T C 10: 59,429,570 N291S probably damaging Het
Olfr362 A T 2: 37,105,169 H160Q possibly damaging Het
Ppfibp1 T C 6: 147,019,503 S580P probably benign Het
Prdx6b A T 2: 80,293,216 D123V probably damaging Het
Ptprs A G 17: 56,424,256 L1050P possibly damaging Het
Rcc1 A C 4: 132,337,799 S138A probably damaging Het
Rimbp3 G T 16: 17,213,201 R1496S possibly damaging Het
Sacs T C 14: 61,191,605 V371A probably benign Het
Sfxn4 A G 19: 60,842,204 L260P possibly damaging Het
Slc17a1 G A 13: 23,878,483 S211N possibly damaging Het
Slc39a11 C T 11: 113,562,092 V8M probably damaging Het
Smpd2 A G 10: 41,489,016 I78T probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Syt17 A T 7: 118,381,884 V462E probably damaging Het
Tlr11 T A 14: 50,361,344 D262E probably benign Het
Tnfrsf9 T C 4: 150,929,874 V10A probably benign Het
Trpv3 C A 11: 73,277,974 Q87K probably benign Het
Ugt1a5 T C 1: 88,166,559 Y170H probably benign Het
Urb1 A G 16: 90,787,408 L562P probably damaging Het
Usp3 G T 9: 66,530,255 N299K probably benign Het
Vmn1r83 T C 7: 12,321,629 Y167C probably damaging Het
Vmn2r117 T A 17: 23,475,565 Y436F probably benign Het
Vps13d A G 4: 145,128,411 I2220T Het
Zfp936 T A 7: 43,187,261 V32D probably damaging Het
Znrd1 T A 17: 36,957,844 L75F probably benign Het
Zswim2 A G 2: 83,920,719 C259R probably damaging Het
Other mutations in Pld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Pld1 APN 3 28045098 critical splice donor site probably null
IGL01090:Pld1 APN 3 28088667 missense probably benign 0.01
IGL01140:Pld1 APN 3 28078237 missense probably benign 0.01
IGL01646:Pld1 APN 3 28099664 missense probably damaging 1.00
IGL01830:Pld1 APN 3 28048004 splice site probably benign
IGL01946:Pld1 APN 3 28124617 missense probably damaging 1.00
IGL02139:Pld1 APN 3 28120812 missense probably damaging 0.98
IGL02189:Pld1 APN 3 28120783 missense probably benign 0.03
IGL02476:Pld1 APN 3 28048039 missense probably damaging 1.00
IGL02540:Pld1 APN 3 28029160 unclassified probably benign
IGL02649:Pld1 APN 3 28087229 missense probably damaging 0.98
IGL02720:Pld1 APN 3 28087262 missense probably damaging 1.00
IGL02831:Pld1 APN 3 28076425 missense probably damaging 0.99
IGL02953:Pld1 APN 3 28112247 missense probably benign 0.03
IGL03005:Pld1 APN 3 28087253 missense possibly damaging 0.78
IGL03251:Pld1 APN 3 28088665 missense probably benign 0.06
IGL03331:Pld1 APN 3 28085845 missense probably damaging 1.00
A9681:Pld1 UTSW 3 28085832 missense probably benign 0.01
IGL03134:Pld1 UTSW 3 28029167 missense probably benign 0.01
P0023:Pld1 UTSW 3 28048125 missense probably damaging 1.00
R0054:Pld1 UTSW 3 28095884 splice site probably benign
R0054:Pld1 UTSW 3 28095884 splice site probably benign
R0282:Pld1 UTSW 3 28078273 missense probably benign
R0372:Pld1 UTSW 3 28088638 splice site probably null
R0454:Pld1 UTSW 3 28124575 missense probably damaging 1.00
R0492:Pld1 UTSW 3 28109817 missense probably damaging 0.96
R0505:Pld1 UTSW 3 28120822 missense possibly damaging 0.69
R0667:Pld1 UTSW 3 28079178 splice site probably null
R0678:Pld1 UTSW 3 28120784 missense probably damaging 0.99
R0980:Pld1 UTSW 3 28124575 missense probably damaging 1.00
R1200:Pld1 UTSW 3 28049286 missense probably damaging 1.00
R1235:Pld1 UTSW 3 28028734 missense probably benign 0.05
R1657:Pld1 UTSW 3 28071187 missense probably benign 0.04
R1670:Pld1 UTSW 3 28049240 missense probably benign 0.17
R1705:Pld1 UTSW 3 28071277 critical splice donor site probably null
R1815:Pld1 UTSW 3 28109768 missense probably benign 0.04
R2215:Pld1 UTSW 3 28078393 missense probably benign 0.16
R3435:Pld1 UTSW 3 28124623 missense probably benign 0.13
R3522:Pld1 UTSW 3 28031247 missense probably damaging 1.00
R4206:Pld1 UTSW 3 28120783 missense probably benign 0.03
R4553:Pld1 UTSW 3 28124702 missense probably benign
R4612:Pld1 UTSW 3 28131733 missense possibly damaging 0.92
R4623:Pld1 UTSW 3 28029244 missense probably benign 0.01
R4840:Pld1 UTSW 3 28076551 missense probably benign 0.10
R4869:Pld1 UTSW 3 28109802 missense possibly damaging 0.84
R4982:Pld1 UTSW 3 28031298 missense probably damaging 0.97
R5087:Pld1 UTSW 3 28124582 missense probably damaging 1.00
R5182:Pld1 UTSW 3 28045081 missense probably damaging 1.00
R5384:Pld1 UTSW 3 28025320 missense probably damaging 1.00
R6243:Pld1 UTSW 3 28095805 missense probably damaging 0.98
R6345:Pld1 UTSW 3 28130747 intron probably benign
R6692:Pld1 UTSW 3 28041199 missense probably benign 0.15
R6881:Pld1 UTSW 3 28078414 missense possibly damaging 0.77
R7197:Pld1 UTSW 3 28024252 missense probably damaging 1.00
R7267:Pld1 UTSW 3 28076401 missense probably damaging 1.00
R7284:Pld1 UTSW 3 28131733 missense possibly damaging 0.92
R7293:Pld1 UTSW 3 28087286 missense probably damaging 0.99
R7524:Pld1 UTSW 3 28024321 missense possibly damaging 0.77
Z1088:Pld1 UTSW 3 28029243 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATATGGTCACTGGCTCTGAGG -3'
(R):5'- TTTCATCCTAGAGTCTGGGAGCTG -3'

Sequencing Primer
(F):5'- CTCTGAGGATGATTGAGCCAAGTG -3'
(R):5'- GTGGTGAACATCTGCTATGCCC -3'
Posted On2019-10-07