Mutagenetix > Incidental Mutation

Incidental Mutation 'R7440:Cntln'

576876

Institutional Source

Beutler Lab

Gene Symbol

Cntln

Ensembl Gene

ENSMUSG00000038070

Gene Name

centlein, centrosomal protein

Synonyms

B430108F07Rik, D530005L17Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.293) question?

Stock #

R7440 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

84884309-85131921 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 85063216 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 877 (T877K)

Ref Sequence

ENSEMBL: ENSMUSP00000044138 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000169371]

AlphaFold

A2AM05

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047023
AA Change: T877K

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: T877K

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
internal_repeat_1	198	219	1.25e-5	PROSPERO
low complexity region	242	251	N/A	INTRINSIC
internal_repeat_1	321	342	1.25e-5	PROSPERO
low complexity region	346	358	N/A	INTRINSIC
coiled coil region	404	433	N/A	INTRINSIC
low complexity region	434	446	N/A	INTRINSIC
coiled coil region	458	481	N/A	INTRINSIC
coiled coil region	516	584	N/A	INTRINSIC
coiled coil region	606	648	N/A	INTRINSIC
coiled coil region	674	780	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
coiled coil region	973	1114	N/A	INTRINSIC
low complexity region	1206	1217	N/A	INTRINSIC
Blast:HisKA	1270	1326	1e-24	BLAST
low complexity region	1327	1348	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169371
AA Change: T876K

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: T876K

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	58	86	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
internal_repeat_1	198	219	1.24e-5	PROSPERO
low complexity region	242	251	N/A	INTRINSIC
internal_repeat_1	321	342	1.24e-5	PROSPERO
low complexity region	346	358	N/A	INTRINSIC
coiled coil region	404	433	N/A	INTRINSIC
low complexity region	434	446	N/A	INTRINSIC
coiled coil region	458	481	N/A	INTRINSIC
coiled coil region	516	584	N/A	INTRINSIC
coiled coil region	606	648	N/A	INTRINSIC
coiled coil region	674	780	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
coiled coil region	972	1113	N/A	INTRINSIC
low complexity region	1205	1216	N/A	INTRINSIC
Blast:HisKA	1269	1325	1e-24	BLAST
low complexity region	1326	1347	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (69/69)

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110032A03Rik	A	G	9: 50,764,913	V35A	probably benign	Het
9230104L09Rik	A	C	2: 148,846,991	C109W	probably damaging	Het
Acadm	G	A	3: 153,922,989	T403I	probably damaging	Het
Adat1	A	T	8: 111,989,898	M64K	probably damaging	Het
Adcy2	C	T	13: 68,796,667	V199M	probably damaging	Het
Ankrd13a	T	C	5: 114,803,575	S508P	possibly damaging	Het
Ap1g1	T	A	8: 109,802,724		probably null	Het
Bicral	C	T	17: 46,825,784	G167R	probably damaging	Het
Ccser2	T	C	14: 36,898,217	K727E	possibly damaging	Het
Cep350	T	G	1: 155,940,772	K332N	probably damaging	Het
Chd5	A	G	4: 152,384,651	N1811S	probably benign	Het
Chpf	A	T	1: 75,475,601	V565D	probably damaging	Het
Clcn6	A	T	4: 148,014,195	L489H	probably damaging	Het
Cog4	T	C	8: 110,879,706	V630A	probably benign	Het
Col6a5	G	T	9: 105,881,431	S2192*	probably null	Het
Cry2	G	A	2: 92,413,638	R397W	probably damaging	Het
Cyp1b1	T	C	17: 79,713,557	N252S	probably damaging	Het
Dhx9	T	C	1: 153,481,231	I91V	probably benign	Het
Dnajb6	G	A	5: 29,757,859	A256T	possibly damaging	Het
Epm2a	T	G	10: 11,390,875	Y121*	probably null	Het
Erlec1	T	C	11: 30,950,818	I117V	possibly damaging	Het
Exoc8	T	C	8: 124,895,781	M616V	probably benign	Het
Fmn1	A	T	2: 113,441,611	Q108L	unknown	Het
Fuz	T	C	7: 44,896,572	L46P	probably damaging	Het
Gm15319	C	T	8: 20,356,948	S254N	unknown	Het
Insc	T	C	7: 114,845,043	S422P	possibly damaging	Het
Intu	A	G	3: 40,697,551	I813V	probably benign	Het
Jak3	T	A	8: 71,680,718	S352T	probably benign	Het
Klf11	T	C	12: 24,655,491	S315P	probably benign	Het
Lrrc63	T	C	14: 75,121,013	N400D	possibly damaging	Het
Lrrk1	T	C	7: 66,290,854	D760G	probably damaging	Het
Macf1	A	T	4: 123,455,446	L3976*	probably null	Het
Map7	C	T	10: 20,261,859	A259V	probably damaging	Het
Meioc	T	A	11: 102,674,237	D170E	possibly damaging	Het
Mgat5b	T	A	11: 116,968,445	Y34*	probably null	Het
Mgst1	A	G	6: 138,150,844	K68R	probably benign	Het
Miga1	T	A	3: 152,338,046		probably null	Het
Mrps33	G	A	6: 39,802,479	P94L	probably damaging	Het
Ncapg2	G	T	12: 116,450,413	G1068C	possibly damaging	Het
Ndufaf7	C	T	17: 78,942,117	H148Y	probably damaging	Het
Nkx6-3	A	T	8: 23,153,754	D57V	probably damaging	Het
Nlrp1a	T	C	11: 71,092,324	D1272G	probably damaging	Het
Oit3	T	C	10: 59,429,570	N291S	probably damaging	Het
Olfr362	A	T	2: 37,105,169	H160Q	possibly damaging	Het
Pld1	T	G	3: 28,041,270	S251A	probably benign	Het
Ppfibp1	T	C	6: 147,019,503	S580P	probably benign	Het
Prdx6b	A	T	2: 80,293,216	D123V	probably damaging	Het
Ptprs	A	G	17: 56,424,256	L1050P	possibly damaging	Het
Rcc1	A	C	4: 132,337,799	S138A	probably damaging	Het
Rimbp3	G	T	16: 17,213,201	R1496S	possibly damaging	Het
Sacs	T	C	14: 61,191,605	V371A	probably benign	Het
Sfxn4	A	G	19: 60,842,204	L260P	possibly damaging	Het
Slc17a1	G	A	13: 23,878,483	S211N	possibly damaging	Het
Slc39a11	C	T	11: 113,562,092	V8M	probably damaging	Het
Smpd2	A	G	10: 41,489,016	I78T	probably benign	Het
Steap3	A	C	1: 120,241,518	F350V	probably benign	Het
Syt17	A	T	7: 118,381,884	V462E	probably damaging	Het
Tlr11	T	A	14: 50,361,344	D262E	probably benign	Het
Tnfrsf9	T	C	4: 150,929,874	V10A	probably benign	Het
Trpv3	C	A	11: 73,277,974	Q87K	probably benign	Het
Ugt1a5	T	C	1: 88,166,559	Y170H	probably benign	Het
Urb1	A	G	16: 90,787,408	L562P	probably damaging	Het
Usp3	G	T	9: 66,530,255	N299K	probably benign	Het
Vmn1r83	T	C	7: 12,321,629	Y167C	probably damaging	Het
Vmn2r117	T	A	17: 23,475,565	Y436F	probably benign	Het
Vps13d	A	G	4: 145,128,411	I2220T		Het
Zfp936	T	A	7: 43,187,261	V32D	probably damaging	Het
Znrd1	T	A	17: 36,957,844	L75F	probably benign	Het
Zswim2	A	G	2: 83,920,719	C259R	probably damaging	Het

Other mutations in Cntln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Cntln	APN	4	85006434	missense	probably benign	0.25
IGL00743:Cntln	APN	4	84979415	missense	probably benign	0.06
IGL01014:Cntln	APN	4	85049908	missense	probably benign	0.25
IGL02217:Cntln	APN	4	85100258	missense	probably damaging	1.00
IGL02323:Cntln	APN	4	85049789	missense	probably benign	0.00
IGL02353:Cntln	APN	4	85049850	missense	probably damaging	0.98
IGL02360:Cntln	APN	4	85049850	missense	probably damaging	0.98
IGL02616:Cntln	APN	4	85115452	critical splice donor site	probably null
PIT4696001:Cntln	UTSW	4	84974000	missense	probably damaging	0.99
R0110:Cntln	UTSW	4	85096757	missense	probably damaging	1.00
R0324:Cntln	UTSW	4	85092695	missense	probably damaging	0.98
R0349:Cntln	UTSW	4	84996485	missense	probably damaging	1.00
R0519:Cntln	UTSW	4	85005053	splice site	probably benign
R0529:Cntln	UTSW	4	85067825	missense	probably damaging	1.00
R0582:Cntln	UTSW	4	84884741	missense	probably damaging	1.00
R1077:Cntln	UTSW	4	84996479	missense	probably damaging	1.00
R1345:Cntln	UTSW	4	84973991	missense	probably damaging	1.00
R1457:Cntln	UTSW	4	85096839	missense	probably benign	0.33
R1571:Cntln	UTSW	4	84947586	nonsense	probably null
R1622:Cntln	UTSW	4	85063181	missense	probably damaging	1.00
R1681:Cntln	UTSW	4	84947635	missense	probably damaging	1.00
R1777:Cntln	UTSW	4	85130679	missense	probably benign	0.23
R1808:Cntln	UTSW	4	85096763	missense	probably damaging	1.00
R1882:Cntln	UTSW	4	85100835	missense	probably damaging	1.00
R2056:Cntln	UTSW	4	85049674	missense	probably benign
R2965:Cntln	UTSW	4	84974027	critical splice donor site	probably null
R2968:Cntln	UTSW	4	84957267	missense	probably benign	0.27
R3104:Cntln	UTSW	4	84957169	missense	possibly damaging	0.95
R3106:Cntln	UTSW	4	84957169	missense	possibly damaging	0.95
R3121:Cntln	UTSW	4	85005052	splice site	probably benign
R3617:Cntln	UTSW	4	85004977	nonsense	probably null
R4009:Cntln	UTSW	4	85063215	missense	probably benign	0.45
R4036:Cntln	UTSW	4	85006488	missense	probably damaging	1.00
R4548:Cntln	UTSW	4	85096842	missense	probably benign	0.27
R4592:Cntln	UTSW	4	84971182	missense	probably benign	0.00
R4666:Cntln	UTSW	4	84971216	missense	probably benign	0.13
R4826:Cntln	UTSW	4	85005044	missense	probably benign	0.03
R4836:Cntln	UTSW	4	85049720	nonsense	probably null
R4856:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R4886:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R4995:Cntln	UTSW	4	85049883	missense	probably benign	0.00
R5090:Cntln	UTSW	4	84947593	missense	probably damaging	0.98
R5202:Cntln	UTSW	4	84971229	missense	probably benign	0.35
R5905:Cntln	UTSW	4	84971173	missense	probably benign	0.03
R5953:Cntln	UTSW	4	85049919	missense	possibly damaging	0.92
R6028:Cntln	UTSW	4	84971173	missense	probably benign	0.03
R6298:Cntln	UTSW	4	85096761	missense	probably damaging	1.00
R6351:Cntln	UTSW	4	85115354	missense	probably damaging	0.99
R6371:Cntln	UTSW	4	84884579	missense	probably damaging	0.98
R6481:Cntln	UTSW	4	85067510	missense	probably benign	0.00
R6864:Cntln	UTSW	4	85096792	missense	probably damaging	0.99
R6874:Cntln	UTSW	4	85067759	missense	probably damaging	1.00
R6919:Cntln	UTSW	4	85115368	missense	probably benign	0.04
R7071:Cntln	UTSW	4	85100385	missense	probably damaging	1.00
R7113:Cntln	UTSW	4	85049827	missense	probably damaging	0.98
R7152:Cntln	UTSW	4	84884700	missense	possibly damaging	0.87
R7253:Cntln	UTSW	4	85118473	missense	probably damaging	1.00
R7289:Cntln	UTSW	4	85046303	missense	possibly damaging	0.80
R7670:Cntln	UTSW	4	84979340	missense	possibly damaging	0.66
R7707:Cntln	UTSW	4	84884616	missense	probably damaging	1.00
R7895:Cntln	UTSW	4	85063324	missense	possibly damaging	0.91
R8176:Cntln	UTSW	4	84888689	missense	probably damaging	0.99
R8247:Cntln	UTSW	4	85100780	missense	probably benign	0.39
R8264:Cntln	UTSW	4	85098411	missense	probably damaging	1.00
R8293:Cntln	UTSW	4	85033838	missense	probably damaging	1.00
R8536:Cntln	UTSW	4	84957049	missense	probably damaging	1.00
R8844:Cntln	UTSW	4	84973997	missense	probably damaging	1.00
R8924:Cntln	UTSW	4	84888699	missense	probably damaging	1.00
R8955:Cntln	UTSW	4	85067873	missense	possibly damaging	0.85
R8960:Cntln	UTSW	4	85100724	missense	possibly damaging	0.59
R8979:Cntln	UTSW	4	85130673	missense	probably damaging	1.00
R9255:Cntln	UTSW	4	85100866	missense	possibly damaging	0.93
R9314:Cntln	UTSW	4	85006482	missense	probably damaging	1.00
R9353:Cntln	UTSW	4	84884360	unclassified	probably benign
R9361:Cntln	UTSW	4	85049914	missense	probably benign	0.23
R9376:Cntln	UTSW	4	84957021	missense	probably benign	0.24
R9382:Cntln	UTSW	4	85050081	missense	probably benign	0.13
R9471:Cntln	UTSW	4	85049782	missense	possibly damaging	0.62
R9478:Cntln	UTSW	4	84979393	missense	probably benign	0.00
R9527:Cntln	UTSW	4	84973883	missense	probably damaging	1.00
R9788:Cntln	UTSW	4	85049856	missense	probably damaging	1.00
R9793:Cntln	UTSW	4	85067561	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGTGCTAGGGATCAAGTTTCC -3'
(R):5'- GGTTAAGAACGTACTGTGGAGC -3'

Sequencing Primer
(F):5'- CTAGGGATCAAGTTTCCTGATGAAG -3'
(R):5'- GCTAAGAAAAGCTAGCATACCTGCG -3'

Posted On

2019-10-07