Mutagenetix > Incidental Mutation

Incidental Mutation 'R7440:Lrrk1'

576891

Institutional Source

Beutler Lab

Gene Symbol

Lrrk1

Ensembl Gene

ENSMUSG00000015133

Gene Name

leucine-rich repeat kinase 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7440 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

66226912-66388350 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 66290854 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 760 (D760G)

Ref Sequence

ENSEMBL: ENSMUSP00000015277 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015277]

AlphaFold

Q3UHC2

Predicted Effect

probably damaging
Transcript: ENSMUST00000015277
AA Change: D760G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000015277
Gene: ENSMUSG00000015133
AA Change: D760G

Domain	Start	End	E-Value	Type
ANK	86	116	9.33e2	SMART
ANK	119	148	1.14e2	SMART
ANK	152	182	8.36e1	SMART
ANK	193	223	2.6e1	SMART
LRR	278	300	2.84e2	SMART
LRR	301	325	7.79e0	SMART
LRR	328	351	3.27e1	SMART
LRR_TYP	379	401	2.53e-2	SMART
LRR	403	427	5.89e1	SMART
LRR	472	493	5.27e1	SMART
LRR	548	569	2.92e2	SMART
LRR	570	594	5.88e0	SMART
Pfam:Arf	625	786	2e-8	PFAM
Pfam:Roc	640	761	3.1e-24	PFAM
Pfam:Ras	640	782	2.2e-7	PFAM
Pfam:COR	844	1046	4.7e-26	PFAM
low complexity region	1109	1119	N/A	INTRINSIC
low complexity region	1209	1222	N/A	INTRINSIC
Pfam:Pkinase	1243	1521	7.8e-40	PFAM
Pfam:Pkinase_Tyr	1244	1520	9.4e-39	PFAM
low complexity region	1642	1654	N/A	INTRINSIC
low complexity region	1839	1846	N/A	INTRINSIC
low complexity region	1852	1871	N/A	INTRINSIC
low complexity region	1957	1970	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is a leucine-rich repeat kinase and a GDP/GTP binding protein. The encoded protein is thought to play a role in the regulation of bone mass. Mice lacking a similar gene showed severe osteopetrosis, increased bone mineralization and decreased bone resorption. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for another knock-out allele exhibit severe osteopetrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110032A03Rik	A	G	9: 50,764,913	V35A	probably benign	Het
9230104L09Rik	A	C	2: 148,846,991	C109W	probably damaging	Het
Acadm	G	A	3: 153,922,989	T403I	probably damaging	Het
Adat1	A	T	8: 111,989,898	M64K	probably damaging	Het
Adcy2	C	T	13: 68,796,667	V199M	probably damaging	Het
Ankrd13a	T	C	5: 114,803,575	S508P	possibly damaging	Het
Ap1g1	T	A	8: 109,802,724		probably null	Het
Bicral	C	T	17: 46,825,784	G167R	probably damaging	Het
Ccser2	T	C	14: 36,898,217	K727E	possibly damaging	Het
Cep350	T	G	1: 155,940,772	K332N	probably damaging	Het
Chd5	A	G	4: 152,384,651	N1811S	probably benign	Het
Chpf	A	T	1: 75,475,601	V565D	probably damaging	Het
Clcn6	A	T	4: 148,014,195	L489H	probably damaging	Het
Cntln	C	A	4: 85,063,216	T877K	possibly damaging	Het
Cog4	T	C	8: 110,879,706	V630A	probably benign	Het
Col6a5	G	T	9: 105,881,431	S2192*	probably null	Het
Cry2	G	A	2: 92,413,638	R397W	probably damaging	Het
Cyp1b1	T	C	17: 79,713,557	N252S	probably damaging	Het
Dhx9	T	C	1: 153,481,231	I91V	probably benign	Het
Dnajb6	G	A	5: 29,757,859	A256T	possibly damaging	Het
Epm2a	T	G	10: 11,390,875	Y121*	probably null	Het
Erlec1	T	C	11: 30,950,818	I117V	possibly damaging	Het
Exoc8	T	C	8: 124,895,781	M616V	probably benign	Het
Fmn1	A	T	2: 113,441,611	Q108L	unknown	Het
Fuz	T	C	7: 44,896,572	L46P	probably damaging	Het
Gm15319	C	T	8: 20,356,948	S254N	unknown	Het
Insc	T	C	7: 114,845,043	S422P	possibly damaging	Het
Intu	A	G	3: 40,697,551	I813V	probably benign	Het
Jak3	T	A	8: 71,680,718	S352T	probably benign	Het
Klf11	T	C	12: 24,655,491	S315P	probably benign	Het
Lrrc63	T	C	14: 75,121,013	N400D	possibly damaging	Het
Macf1	A	T	4: 123,455,446	L3976*	probably null	Het
Map7	C	T	10: 20,261,859	A259V	probably damaging	Het
Meioc	T	A	11: 102,674,237	D170E	possibly damaging	Het
Mgat5b	T	A	11: 116,968,445	Y34*	probably null	Het
Mgst1	A	G	6: 138,150,844	K68R	probably benign	Het
Miga1	T	A	3: 152,338,046		probably null	Het
Mrps33	G	A	6: 39,802,479	P94L	probably damaging	Het
Ncapg2	G	T	12: 116,450,413	G1068C	possibly damaging	Het
Ndufaf7	C	T	17: 78,942,117	H148Y	probably damaging	Het
Nkx6-3	A	T	8: 23,153,754	D57V	probably damaging	Het
Nlrp1a	T	C	11: 71,092,324	D1272G	probably damaging	Het
Oit3	T	C	10: 59,429,570	N291S	probably damaging	Het
Olfr362	A	T	2: 37,105,169	H160Q	possibly damaging	Het
Pld1	T	G	3: 28,041,270	S251A	probably benign	Het
Ppfibp1	T	C	6: 147,019,503	S580P	probably benign	Het
Prdx6b	A	T	2: 80,293,216	D123V	probably damaging	Het
Ptprs	A	G	17: 56,424,256	L1050P	possibly damaging	Het
Rcc1	A	C	4: 132,337,799	S138A	probably damaging	Het
Rimbp3	G	T	16: 17,213,201	R1496S	possibly damaging	Het
Sacs	T	C	14: 61,191,605	V371A	probably benign	Het
Sfxn4	A	G	19: 60,842,204	L260P	possibly damaging	Het
Slc17a1	G	A	13: 23,878,483	S211N	possibly damaging	Het
Slc39a11	C	T	11: 113,562,092	V8M	probably damaging	Het
Smpd2	A	G	10: 41,489,016	I78T	probably benign	Het
Steap3	A	C	1: 120,241,518	F350V	probably benign	Het
Syt17	A	T	7: 118,381,884	V462E	probably damaging	Het
Tlr11	T	A	14: 50,361,344	D262E	probably benign	Het
Tnfrsf9	T	C	4: 150,929,874	V10A	probably benign	Het
Trpv3	C	A	11: 73,277,974	Q87K	probably benign	Het
Ugt1a5	T	C	1: 88,166,559	Y170H	probably benign	Het
Urb1	A	G	16: 90,787,408	L562P	probably damaging	Het
Usp3	G	T	9: 66,530,255	N299K	probably benign	Het
Vmn1r83	T	C	7: 12,321,629	Y167C	probably damaging	Het
Vmn2r117	T	A	17: 23,475,565	Y436F	probably benign	Het
Vps13d	A	G	4: 145,128,411	I2220T		Het
Zfp936	T	A	7: 43,187,261	V32D	probably damaging	Het
Znrd1	T	A	17: 36,957,844	L75F	probably benign	Het
Zswim2	A	G	2: 83,920,719	C259R	probably damaging	Het

Other mutations in Lrrk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01365:Lrrk1	APN	7	66287701	missense	probably damaging	1.00
IGL01511:Lrrk1	APN	7	66265450	missense	possibly damaging	0.48
IGL02337:Lrrk1	APN	7	66279416	missense	possibly damaging	0.92
IGL02636:Lrrk1	APN	7	66308659	critical splice donor site	probably null
IGL02679:Lrrk1	APN	7	66274872	missense	probably damaging	1.00
IGL02711:Lrrk1	APN	7	66330767	missense	probably damaging	1.00
IGL02742:Lrrk1	APN	7	66308691	missense	probably benign	0.12
IGL02878:Lrrk1	APN	7	66262563	missense	probably benign
IGL03135:Lrrk1	APN	7	66262890	missense	probably benign	0.00
IGL03191:Lrrk1	APN	7	66259959	missense	probably damaging	0.99
IGL03198:Lrrk1	APN	7	66306894	missense	probably damaging	1.00
combustion	UTSW	7	66262665	missense	possibly damaging	0.94
fluorine	UTSW	7	66302710	missense	possibly damaging	0.89
halide	UTSW	7	66265474	missense	possibly damaging	0.82
Heiland	UTSW	7	66262733	missense	probably damaging	0.96
liebster	UTSW	7	66294981	missense	probably damaging	1.00
magi	UTSW	7	66281648	missense	probably damaging	1.00
oxidation	UTSW	7	66279372	missense	probably benign	0.00
phlogiston	UTSW	7	66278520	splice site	probably benign
Savior	UTSW	7	66262487	missense	probably damaging	1.00
wenig	UTSW	7	66273001	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0105:Lrrk1	UTSW	7	66292341	missense	probably damaging	1.00
R0276:Lrrk1	UTSW	7	66296263	splice site	probably benign
R0505:Lrrk1	UTSW	7	66290908	splice site	probably null
R0609:Lrrk1	UTSW	7	66266615	splice site	probably null
R0650:Lrrk1	UTSW	7	66292336	missense	probably damaging	1.00
R0676:Lrrk1	UTSW	7	66294981	missense	probably damaging	1.00
R1157:Lrrk1	UTSW	7	66262283	missense	probably benign	0.00
R1435:Lrrk1	UTSW	7	66273028	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1468:Lrrk1	UTSW	7	66259974	missense	probably damaging	1.00
R1498:Lrrk1	UTSW	7	66302671	nonsense	probably null
R1620:Lrrk1	UTSW	7	66381538	missense	probably benign	0.00
R1884:Lrrk1	UTSW	7	66262437	missense	probably benign
R1891:Lrrk1	UTSW	7	66279300	missense	probably damaging	1.00
R1989:Lrrk1	UTSW	7	66281684	missense	probably damaging	1.00
R2107:Lrrk1	UTSW	7	66279282	missense	probably damaging	1.00
R2140:Lrrk1	UTSW	7	66330750	missense	probably damaging	1.00
R2144:Lrrk1	UTSW	7	66296163	missense	probably damaging	0.98
R2147:Lrrk1	UTSW	7	66285411	splice site	probably null
R3176:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3276:Lrrk1	UTSW	7	66305521	missense	possibly damaging	0.69
R3886:Lrrk1	UTSW	7	66292364	missense	probably damaging	1.00
R3893:Lrrk1	UTSW	7	66278520	splice site	probably benign
R3906:Lrrk1	UTSW	7	66294903	missense	possibly damaging	0.84
R4259:Lrrk1	UTSW	7	66330764	missense	probably damaging	1.00
R4649:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4653:Lrrk1	UTSW	7	66273053	missense	probably benign	0.12
R4672:Lrrk1	UTSW	7	66279372	missense	probably benign	0.00
R4693:Lrrk1	UTSW	7	66262487	missense	probably damaging	1.00
R4729:Lrrk1	UTSW	7	66262293	missense	probably benign
R4737:Lrrk1	UTSW	7	66306873	missense	probably benign	0.09
R4795:Lrrk1	UTSW	7	66262665	missense	possibly damaging	0.94
R4911:Lrrk1	UTSW	7	66295454	missense	probably damaging	0.97
R5002:Lrrk1	UTSW	7	66332363	missense	probably damaging	1.00
R5254:Lrrk1	UTSW	7	66307107	missense	probably benign	0.00
R5407:Lrrk1	UTSW	7	66270797	missense	probably benign	0.20
R5482:Lrrk1	UTSW	7	66330670	missense	probably benign
R5600:Lrrk1	UTSW	7	66307215	missense	probably benign	0.31
R5615:Lrrk1	UTSW	7	66287615	missense	probably damaging	1.00
R6041:Lrrk1	UTSW	7	66262133	missense	probably benign
R6211:Lrrk1	UTSW	7	66302710	missense	possibly damaging	0.89
R6271:Lrrk1	UTSW	7	66307103	critical splice donor site	probably null
R6276:Lrrk1	UTSW	7	66306839	splice site	probably null
R6447:Lrrk1	UTSW	7	66302728	missense	probably benign	0.19
R6478:Lrrk1	UTSW	7	66262733	missense	probably damaging	0.96
R6615:Lrrk1	UTSW	7	66281648	missense	probably damaging	1.00
R6745:Lrrk1	UTSW	7	66273001	missense	probably damaging	1.00
R6836:Lrrk1	UTSW	7	66342779	missense	probably benign	0.05
R6995:Lrrk1	UTSW	7	66292342	missense	probably damaging	1.00
R7107:Lrrk1	UTSW	7	66287443	missense	possibly damaging	0.94
R7137:Lrrk1	UTSW	7	66285279	missense	probably benign	0.06
R7203:Lrrk1	UTSW	7	66270825	missense	probably damaging	1.00
R7224:Lrrk1	UTSW	7	66332386	missense	probably damaging	0.99
R7239:Lrrk1	UTSW	7	66262155	missense	probably benign
R7515:Lrrk1	UTSW	7	66262562	missense	probably benign
R7593:Lrrk1	UTSW	7	66308691	missense	probably benign	0.12
R7728:Lrrk1	UTSW	7	66262715	missense	probably benign	0.00
R7984:Lrrk1	UTSW	7	66300729	splice site	probably null
R7993:Lrrk1	UTSW	7	66262454	missense	probably benign	0.00
R8009:Lrrk1	UTSW	7	66265474	missense	possibly damaging	0.82
R8037:Lrrk1	UTSW	7	66285341	missense	probably benign
R8101:Lrrk1	UTSW	7	66342782	missense	probably benign
R8116:Lrrk1	UTSW	7	66262623	missense	possibly damaging	0.95
R8126:Lrrk1	UTSW	7	66292315	missense	probably damaging	1.00
R8278:Lrrk1	UTSW	7	66278684	missense	probably benign	0.37
R8559:Lrrk1	UTSW	7	66282327	missense	possibly damaging	0.48
R8669:Lrrk1	UTSW	7	66262596	missense	probably benign	0.20
R8690:Lrrk1	UTSW	7	66302729	missense	probably benign	0.02
R8955:Lrrk1	UTSW	7	66269825	missense	probably benign	0.09
R9135:Lrrk1	UTSW	7	66278609	missense	probably damaging	1.00
R9380:Lrrk1	UTSW	7	66278583	missense	probably damaging	1.00
R9625:Lrrk1	UTSW	7	66259918	makesense	probably null
R9721:Lrrk1	UTSW	7	66274875	missense	probably damaging	1.00
RF018:Lrrk1	UTSW	7	66381502	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- GGCTCATCCCCATGACAGATTC -3'
(R):5'- TCAGTTCATAACGGACCCATG -3'

Sequencing Primer
(F):5'- CCATGACAGATTCCAGGCAGG -3'
(R):5'- CGGACCCATGATGTTAGAGTC -3'

Posted On

2019-10-07