Incidental Mutation 'R7440:Syt17'
ID 576893
Institutional Source Beutler Lab
Gene Symbol Syt17
Ensembl Gene ENSMUSG00000058420
Gene Name synaptotagmin XVII
Synonyms Bk
MMRRC Submission 045516-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7440 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 117979940-118047445 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 117981107 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 462 (V462E)
Ref Sequence ENSEMBL: ENSMUSP00000080284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081574] [ENSMUST00000203465] [ENSMUST00000203796]
AlphaFold Q920M7
Predicted Effect probably damaging
Transcript: ENSMUST00000081574
AA Change: V462E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080284
Gene: ENSMUSG00000058420
AA Change: V462E

DomainStartEndE-ValueType
low complexity region 90 102 N/A INTRINSIC
low complexity region 103 118 N/A INTRINSIC
low complexity region 159 172 N/A INTRINSIC
C2 196 305 7.92e-19 SMART
low complexity region 315 328 N/A INTRINSIC
C2 333 448 2.8e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203465
AA Change: V461E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000203796
AA Change: V405E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000145087
Gene: ENSMUSG00000058420
AA Change: V405E

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
low complexity region 46 61 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
C2 139 248 5.2e-21 SMART
low complexity region 258 271 N/A INTRINSIC
C2 276 391 1.9e-21 SMART
Meta Mutation Damage Score 0.2597 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm G A 3: 153,628,626 (GRCm39) T403I probably damaging Het
Adat1 A T 8: 112,716,530 (GRCm39) M64K probably damaging Het
Adcy2 C T 13: 68,944,786 (GRCm39) V199M probably damaging Het
Ankrd13a T C 5: 114,941,636 (GRCm39) S508P possibly damaging Het
Ap1g1 T A 8: 110,529,356 (GRCm39) probably null Het
Bicral C T 17: 47,136,710 (GRCm39) G167R probably damaging Het
Ccser2 T C 14: 36,620,174 (GRCm39) K727E possibly damaging Het
Cep350 T G 1: 155,816,518 (GRCm39) K332N probably damaging Het
Cfap68 A G 9: 50,676,213 (GRCm39) V35A probably benign Het
Chd5 A G 4: 152,469,108 (GRCm39) N1811S probably benign Het
Chpf A T 1: 75,452,245 (GRCm39) V565D probably damaging Het
Clcn6 A T 4: 148,098,652 (GRCm39) L489H probably damaging Het
Cntln C A 4: 84,981,453 (GRCm39) T877K possibly damaging Het
Cog4 T C 8: 111,606,338 (GRCm39) V630A probably benign Het
Col6a5 G T 9: 105,758,630 (GRCm39) S2192* probably null Het
Cry2 G A 2: 92,243,983 (GRCm39) R397W probably damaging Het
Cstdc2 A C 2: 148,688,911 (GRCm39) C109W probably damaging Het
Cyp1b1 T C 17: 80,020,986 (GRCm39) N252S probably damaging Het
Dhx9 T C 1: 153,356,977 (GRCm39) I91V probably benign Het
Dnajb6 G A 5: 29,962,857 (GRCm39) A256T possibly damaging Het
Epm2a T G 10: 11,266,619 (GRCm39) Y121* probably null Het
Erlec1 T C 11: 30,900,818 (GRCm39) I117V possibly damaging Het
Exoc8 T C 8: 125,622,520 (GRCm39) M616V probably benign Het
Fmn1 A T 2: 113,271,956 (GRCm39) Q108L unknown Het
Fuz T C 7: 44,545,996 (GRCm39) L46P probably damaging Het
Insc T C 7: 114,444,278 (GRCm39) S422P possibly damaging Het
Intu A G 3: 40,651,981 (GRCm39) I813V probably benign Het
Jak3 T A 8: 72,133,362 (GRCm39) S352T probably benign Het
Klf11 T C 12: 24,705,490 (GRCm39) S315P probably benign Het
Lrrc63 T C 14: 75,358,453 (GRCm39) N400D possibly damaging Het
Lrrk1 T C 7: 65,940,602 (GRCm39) D760G probably damaging Het
Macf1 A T 4: 123,349,239 (GRCm39) L3976* probably null Het
Map7 C T 10: 20,137,605 (GRCm39) A259V probably damaging Het
Meioc T A 11: 102,565,063 (GRCm39) D170E possibly damaging Het
Mgat5b T A 11: 116,859,271 (GRCm39) Y34* probably null Het
Mgst1 A G 6: 138,127,842 (GRCm39) K68R probably benign Het
Miga1 T A 3: 152,043,683 (GRCm39) probably null Het
Mrps33 G A 6: 39,779,413 (GRCm39) P94L probably damaging Het
Ncapg2 G T 12: 116,414,033 (GRCm39) G1068C possibly damaging Het
Ndufaf7 C T 17: 79,249,546 (GRCm39) H148Y probably damaging Het
Nkx6-3 A T 8: 23,643,770 (GRCm39) D57V probably damaging Het
Nlrp1a T C 11: 70,983,150 (GRCm39) D1272G probably damaging Het
Oit3 T C 10: 59,265,392 (GRCm39) N291S probably damaging Het
Or1b1 A T 2: 36,995,181 (GRCm39) H160Q possibly damaging Het
Pld1 T G 3: 28,095,419 (GRCm39) S251A probably benign Het
Polr1h T A 17: 37,268,736 (GRCm39) L75F probably benign Het
Potefam3a C T 8: 20,356,948 (GRCm38) S254N unknown Het
Ppfibp1 T C 6: 146,921,001 (GRCm39) S580P probably benign Het
Prdx6b A T 2: 80,123,560 (GRCm39) D123V probably damaging Het
Ptprs A G 17: 56,731,256 (GRCm39) L1050P possibly damaging Het
Rcc1 A C 4: 132,065,110 (GRCm39) S138A probably damaging Het
Rimbp3 G T 16: 17,031,065 (GRCm39) R1496S possibly damaging Het
Sacs T C 14: 61,429,054 (GRCm39) V371A probably benign Het
Sfxn4 A G 19: 60,830,642 (GRCm39) L260P possibly damaging Het
Slc17a1 G A 13: 24,062,466 (GRCm39) S211N possibly damaging Het
Slc39a11 C T 11: 113,452,918 (GRCm39) V8M probably damaging Het
Smpd2 A G 10: 41,365,012 (GRCm39) I78T probably benign Het
Steap3 A C 1: 120,169,248 (GRCm39) F350V probably benign Het
Tlr11 T A 14: 50,598,801 (GRCm39) D262E probably benign Het
Tnfrsf9 T C 4: 151,014,331 (GRCm39) V10A probably benign Het
Trpv3 C A 11: 73,168,800 (GRCm39) Q87K probably benign Het
Ugt1a5 T C 1: 88,094,281 (GRCm39) Y170H probably benign Het
Urb1 A G 16: 90,584,296 (GRCm39) L562P probably damaging Het
Usp3 G T 9: 66,437,537 (GRCm39) N299K probably benign Het
Vmn1r83 T C 7: 12,055,556 (GRCm39) Y167C probably damaging Het
Vmn2r117 T A 17: 23,694,539 (GRCm39) Y436F probably benign Het
Vps13d A G 4: 144,854,981 (GRCm39) I2220T Het
Zfp936 T A 7: 42,836,685 (GRCm39) V32D probably damaging Het
Zswim2 A G 2: 83,751,063 (GRCm39) C259R probably damaging Het
Other mutations in Syt17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Syt17 APN 7 118,033,513 (GRCm39) missense probably damaging 0.98
IGL01135:Syt17 APN 7 117,981,270 (GRCm39) missense possibly damaging 0.92
IGL01331:Syt17 APN 7 118,007,389 (GRCm39) missense probably damaging 0.99
IGL01610:Syt17 APN 7 118,033,216 (GRCm39) missense possibly damaging 0.90
IGL01776:Syt17 APN 7 118,009,176 (GRCm39) missense probably damaging 0.99
IGL02125:Syt17 APN 7 118,009,197 (GRCm39) missense probably benign 0.01
IGL02819:Syt17 APN 7 118,009,143 (GRCm39) splice site probably benign
H8562:Syt17 UTSW 7 118,007,292 (GRCm39) missense probably benign 0.01
R0127:Syt17 UTSW 7 118,009,164 (GRCm39) missense probably damaging 0.98
R0328:Syt17 UTSW 7 117,981,216 (GRCm39) missense probably benign 0.28
R1789:Syt17 UTSW 7 118,036,061 (GRCm39) missense probably benign 0.00
R1872:Syt17 UTSW 7 118,007,341 (GRCm39) missense probably benign 0.00
R1878:Syt17 UTSW 7 118,033,468 (GRCm39) missense probably benign 0.01
R1918:Syt17 UTSW 7 118,033,208 (GRCm39) missense possibly damaging 0.54
R2133:Syt17 UTSW 7 117,981,270 (GRCm39) missense possibly damaging 0.92
R3777:Syt17 UTSW 7 118,033,180 (GRCm39) missense probably damaging 1.00
R4471:Syt17 UTSW 7 118,036,040 (GRCm39) splice site probably null
R4472:Syt17 UTSW 7 118,036,040 (GRCm39) splice site probably null
R4567:Syt17 UTSW 7 118,033,495 (GRCm39) missense probably benign 0.06
R5211:Syt17 UTSW 7 118,041,626 (GRCm39) missense probably benign 0.19
R5905:Syt17 UTSW 7 118,036,141 (GRCm39) missense probably benign 0.10
R6054:Syt17 UTSW 7 118,007,356 (GRCm39) missense possibly damaging 0.91
R6276:Syt17 UTSW 7 118,033,513 (GRCm39) missense probably damaging 0.98
R6332:Syt17 UTSW 7 118,033,466 (GRCm39) missense probably benign 0.00
R7022:Syt17 UTSW 7 118,007,242 (GRCm39) missense probably benign 0.00
R7610:Syt17 UTSW 7 118,033,682 (GRCm39) splice site probably null
R7845:Syt17 UTSW 7 118,009,194 (GRCm39) missense possibly damaging 0.79
R8294:Syt17 UTSW 7 118,009,228 (GRCm39) missense probably damaging 0.99
R8296:Syt17 UTSW 7 118,036,069 (GRCm39) missense probably damaging 0.97
R8429:Syt17 UTSW 7 118,033,564 (GRCm39) missense probably benign
R8949:Syt17 UTSW 7 118,033,054 (GRCm39) critical splice donor site probably null
R9278:Syt17 UTSW 7 118,033,480 (GRCm39) missense probably damaging 1.00
R9622:Syt17 UTSW 7 118,036,191 (GRCm39) missense probably benign
R9629:Syt17 UTSW 7 118,007,379 (GRCm39) missense probably damaging 0.96
Z1177:Syt17 UTSW 7 118,033,446 (GRCm39) missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CCCAGCTTGTGATTTATGCATG -3'
(R):5'- TAGTGTTCGGCCACAACATG -3'

Sequencing Primer
(F):5'- ATGATCAACTGTCAGCTCGC -3'
(R):5'- TGAAAAGCAGCAATGACTTCATCG -3'
Posted On 2019-10-07