Incidental Mutation 'R7440:Erlec1'
ID576907
Institutional Source Beutler Lab
Gene Symbol Erlec1
Ensembl Gene ENSMUSG00000020311
Gene Nameendoplasmic reticulum lectin 1
Synonyms4933407N01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7440 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location30930774-30954335 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30950818 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 117 (I117V)
Ref Sequence ENSEMBL: ENSMUSP00000072929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020551] [ENSMUST00000073192] [ENSMUST00000117883] [ENSMUST00000129593] [ENSMUST00000137306] [ENSMUST00000203878]
Predicted Effect probably benign
Transcript: ENSMUST00000020551
SMART Domains Protein: ENSMUSP00000020551
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 1.23e0 SMART
ANK 78 107 7.3e-3 SMART
ANK 111 140 2.66e-5 SMART
ANK 145 174 2.73e-2 SMART
ANK 178 207 2.81e-4 SMART
ANK 211 240 1.88e-5 SMART
ANK 246 276 1.6e2 SMART
ANK 279 308 1.9e-1 SMART
ANK 315 346 1.17e2 SMART
SOCS_box 460 502 2.1e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000073192
AA Change: I117V

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000072929
Gene: ENSMUSG00000020311
AA Change: I117V

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:PRKCSH 111 199 6.6e-21 PFAM
Pfam:PRKCSH 342 421 2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117883
SMART Domains Protein: ENSMUSP00000113072
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 1.23e0 SMART
ANK 78 107 7.3e-3 SMART
ANK 111 140 2.66e-5 SMART
ANK 145 174 2.73e-2 SMART
ANK 178 207 2.81e-4 SMART
ANK 211 240 1.88e-5 SMART
ANK 246 276 1.6e2 SMART
ANK 279 308 1.9e-1 SMART
ANK 315 346 1.17e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129593
SMART Domains Protein: ENSMUSP00000129078
Gene: ENSMUSG00000020311

DomainStartEndE-ValueType
SCOP:d1c39a_ 2 52 1e-3 SMART
Pfam:PRKCSH 149 225 1.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137306
SMART Domains Protein: ENSMUSP00000114692
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
ANK 9 38 5.29e0 SMART
ANK 42 71 4.3e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143126
SMART Domains Protein: ENSMUSP00000126490
Gene: ENSMUSG00000020311

DomainStartEndE-ValueType
Pfam:PRKCSH 52 80 2.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203878
SMART Domains Protein: ENSMUSP00000144900
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
ANK 48 77 3.5e-2 SMART
ANK 81 110 8e-3 SMART
ANK 117 146 4.8e-5 SMART
ANK 150 179 1.7e-7 SMART
ANK 184 213 1.8e-4 SMART
ANK 217 246 1.8e-6 SMART
ANK 250 279 1.2e-7 SMART
ANK 285 315 1.1e0 SMART
ANK 318 347 1.2e-3 SMART
ANK 354 385 7.7e-1 SMART
SOCS 493 542 2.8e-4 SMART
SOCS_box 499 541 1.6e-17 SMART
Meta Mutation Damage Score 0.1364 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a resident endoplasmic reticulum (ER) protein that functions in N-glycan recognition. This protein is thought to be involved in ER-associated degradation via its interaction with the membrane-associated ubiquitin ligase complex. It also functions as a regulator of multiple cellular stress-response pathways in a manner that promotes metastatic cell survival. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 21. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik A G 9: 50,764,913 V35A probably benign Het
9230104L09Rik A C 2: 148,846,991 C109W probably damaging Het
Acadm G A 3: 153,922,989 T403I probably damaging Het
Adat1 A T 8: 111,989,898 M64K probably damaging Het
Adcy2 C T 13: 68,796,667 V199M probably damaging Het
Ankrd13a T C 5: 114,803,575 S508P possibly damaging Het
Ap1g1 T A 8: 109,802,724 probably null Het
Bicral C T 17: 46,825,784 G167R probably damaging Het
Ccser2 T C 14: 36,898,217 K727E possibly damaging Het
Cep350 T G 1: 155,940,772 K332N probably damaging Het
Chd5 A G 4: 152,384,651 N1811S probably benign Het
Chpf A T 1: 75,475,601 V565D probably damaging Het
Clcn6 A T 4: 148,014,195 L489H probably damaging Het
Cntln C A 4: 85,063,216 T877K possibly damaging Het
Cog4 T C 8: 110,879,706 V630A probably benign Het
Col6a5 G T 9: 105,881,431 S2192* probably null Het
Cry2 G A 2: 92,413,638 R397W probably damaging Het
Cyp1b1 T C 17: 79,713,557 N252S probably damaging Het
Dhx9 T C 1: 153,481,231 I91V probably benign Het
Dnajb6 G A 5: 29,757,859 A256T possibly damaging Het
Epm2a T G 10: 11,390,875 Y121* probably null Het
Exoc8 T C 8: 124,895,781 M616V probably benign Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Fuz T C 7: 44,896,572 L46P probably damaging Het
Gm15319 C T 8: 20,356,948 S254N unknown Het
Insc T C 7: 114,845,043 S422P possibly damaging Het
Intu A G 3: 40,697,551 I813V probably benign Het
Jak3 T A 8: 71,680,718 S352T probably benign Het
Klf11 T C 12: 24,655,491 S315P probably benign Het
Lrrc63 T C 14: 75,121,013 N400D possibly damaging Het
Lrrk1 T C 7: 66,290,854 D760G probably damaging Het
Macf1 A T 4: 123,455,446 L3976* probably null Het
Map7 C T 10: 20,261,859 A259V probably damaging Het
Meioc T A 11: 102,674,237 D170E possibly damaging Het
Mgat5b T A 11: 116,968,445 Y34* probably null Het
Mgst1 A G 6: 138,150,844 K68R probably benign Het
Miga1 T A 3: 152,338,046 probably null Het
Mrps33 G A 6: 39,802,479 P94L probably damaging Het
Ncapg2 G T 12: 116,450,413 G1068C possibly damaging Het
Ndufaf7 C T 17: 78,942,117 H148Y probably damaging Het
Nkx6-3 A T 8: 23,153,754 D57V probably damaging Het
Nlrp1a T C 11: 71,092,324 D1272G probably damaging Het
Oit3 T C 10: 59,429,570 N291S probably damaging Het
Olfr362 A T 2: 37,105,169 H160Q possibly damaging Het
Pld1 T G 3: 28,041,270 S251A probably benign Het
Ppfibp1 T C 6: 147,019,503 S580P probably benign Het
Prdx6b A T 2: 80,293,216 D123V probably damaging Het
Ptprs A G 17: 56,424,256 L1050P possibly damaging Het
Rcc1 A C 4: 132,337,799 S138A probably damaging Het
Rimbp3 G T 16: 17,213,201 R1496S possibly damaging Het
Sacs T C 14: 61,191,605 V371A probably benign Het
Sfxn4 A G 19: 60,842,204 L260P possibly damaging Het
Slc17a1 G A 13: 23,878,483 S211N possibly damaging Het
Slc39a11 C T 11: 113,562,092 V8M probably damaging Het
Smpd2 A G 10: 41,489,016 I78T probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Syt17 A T 7: 118,381,884 V462E probably damaging Het
Tlr11 T A 14: 50,361,344 D262E probably benign Het
Tnfrsf9 T C 4: 150,929,874 V10A probably benign Het
Trpv3 C A 11: 73,277,974 Q87K probably benign Het
Ugt1a5 T C 1: 88,166,559 Y170H probably benign Het
Urb1 A G 16: 90,787,408 L562P probably damaging Het
Usp3 G T 9: 66,530,255 N299K probably benign Het
Vmn1r83 T C 7: 12,321,629 Y167C probably damaging Het
Vmn2r117 T A 17: 23,475,565 Y436F probably benign Het
Vps13d A G 4: 145,128,411 I2220T Het
Zfp936 T A 7: 43,187,261 V32D probably damaging Het
Znrd1 T A 17: 36,957,844 L75F probably benign Het
Zswim2 A G 2: 83,920,719 C259R probably damaging Het
Other mutations in Erlec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Erlec1 APN 11 30948510 missense possibly damaging 0.84
IGL00537:Erlec1 APN 11 30939591 missense probably benign 0.04
IGL00766:Erlec1 APN 11 30950623 nonsense probably null
IGL01760:Erlec1 APN 11 30934731 missense probably benign 0.34
IGL02505:Erlec1 APN 11 30950767 missense probably damaging 1.00
IGL02633:Erlec1 APN 11 30948430 nonsense probably null
R0674:Erlec1 UTSW 11 30935073 intron probably benign
R1211:Erlec1 UTSW 11 30948298 critical splice donor site probably null
R1974:Erlec1 UTSW 11 30939604 missense possibly damaging 0.83
R4326:Erlec1 UTSW 11 30949972 missense probably benign
R4328:Erlec1 UTSW 11 30949972 missense probably benign
R4392:Erlec1 UTSW 11 30943697 critical splice donor site probably null
R4641:Erlec1 UTSW 11 30948442 nonsense probably null
R4697:Erlec1 UTSW 11 30952640 missense probably benign 0.27
R4917:Erlec1 UTSW 11 30934710 missense possibly damaging 0.56
R5486:Erlec1 UTSW 11 30935047 missense probably damaging 0.98
R5735:Erlec1 UTSW 11 30950591 missense probably benign 0.00
R5775:Erlec1 UTSW 11 30943848 missense probably benign 0.11
R6475:Erlec1 UTSW 11 30948442 nonsense probably null
R7027:Erlec1 UTSW 11 30950790 missense probably damaging 1.00
R7235:Erlec1 UTSW 11 30950751 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TCTTAGCCAACATATTCCCAAGG -3'
(R):5'- TAGCCCGATAGTTATTACAGACC -3'

Sequencing Primer
(F):5'- GCCAACATATTCCCAAGGTAGTATTC -3'
(R):5'- TATTACAGACCTAAATAAGCCCTAGC -3'
Posted On2019-10-07