Incidental Mutation 'R7440:Meioc'
ID 576910
Institutional Source Beutler Lab
Gene Symbol Meioc
Ensembl Gene ENSMUSG00000051455
Gene Name meiosis specific with coiled-coil domain
Synonyms LOC380729, LOC268491, Gm1564
MMRRC Submission 045516-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R7440 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 102556177-102573066 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 102565063 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 170 (D170E)
Ref Sequence ENSEMBL: ENSMUSP00000116246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100378] [ENSMUST00000156590]
AlphaFold A2AG06
Predicted Effect possibly damaging
Transcript: ENSMUST00000100378
AA Change: D226E

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097947
Gene: ENSMUSG00000051455
AA Change: D226E

DomainStartEndE-ValueType
low complexity region 526 537 N/A INTRINSIC
low complexity region 712 728 N/A INTRINSIC
Pfam:DUF4582 757 922 5.1e-89 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000156590
AA Change: D170E

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116246
Gene: ENSMUSG00000051455
AA Change: D170E

DomainStartEndE-ValueType
low complexity region 470 481 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (69/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit infertility with small gonads, absent germ cells and arrested meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm G A 3: 153,628,626 (GRCm39) T403I probably damaging Het
Adat1 A T 8: 112,716,530 (GRCm39) M64K probably damaging Het
Adcy2 C T 13: 68,944,786 (GRCm39) V199M probably damaging Het
Ankrd13a T C 5: 114,941,636 (GRCm39) S508P possibly damaging Het
Ap1g1 T A 8: 110,529,356 (GRCm39) probably null Het
Bicral C T 17: 47,136,710 (GRCm39) G167R probably damaging Het
Ccser2 T C 14: 36,620,174 (GRCm39) K727E possibly damaging Het
Cep350 T G 1: 155,816,518 (GRCm39) K332N probably damaging Het
Cfap68 A G 9: 50,676,213 (GRCm39) V35A probably benign Het
Chd5 A G 4: 152,469,108 (GRCm39) N1811S probably benign Het
Chpf A T 1: 75,452,245 (GRCm39) V565D probably damaging Het
Clcn6 A T 4: 148,098,652 (GRCm39) L489H probably damaging Het
Cntln C A 4: 84,981,453 (GRCm39) T877K possibly damaging Het
Cog4 T C 8: 111,606,338 (GRCm39) V630A probably benign Het
Col6a5 G T 9: 105,758,630 (GRCm39) S2192* probably null Het
Cry2 G A 2: 92,243,983 (GRCm39) R397W probably damaging Het
Cstdc2 A C 2: 148,688,911 (GRCm39) C109W probably damaging Het
Cyp1b1 T C 17: 80,020,986 (GRCm39) N252S probably damaging Het
Dhx9 T C 1: 153,356,977 (GRCm39) I91V probably benign Het
Dnajb6 G A 5: 29,962,857 (GRCm39) A256T possibly damaging Het
Epm2a T G 10: 11,266,619 (GRCm39) Y121* probably null Het
Erlec1 T C 11: 30,900,818 (GRCm39) I117V possibly damaging Het
Exoc8 T C 8: 125,622,520 (GRCm39) M616V probably benign Het
Fmn1 A T 2: 113,271,956 (GRCm39) Q108L unknown Het
Fuz T C 7: 44,545,996 (GRCm39) L46P probably damaging Het
Insc T C 7: 114,444,278 (GRCm39) S422P possibly damaging Het
Intu A G 3: 40,651,981 (GRCm39) I813V probably benign Het
Jak3 T A 8: 72,133,362 (GRCm39) S352T probably benign Het
Klf11 T C 12: 24,705,490 (GRCm39) S315P probably benign Het
Lrrc63 T C 14: 75,358,453 (GRCm39) N400D possibly damaging Het
Lrrk1 T C 7: 65,940,602 (GRCm39) D760G probably damaging Het
Macf1 A T 4: 123,349,239 (GRCm39) L3976* probably null Het
Map7 C T 10: 20,137,605 (GRCm39) A259V probably damaging Het
Mgat5b T A 11: 116,859,271 (GRCm39) Y34* probably null Het
Mgst1 A G 6: 138,127,842 (GRCm39) K68R probably benign Het
Miga1 T A 3: 152,043,683 (GRCm39) probably null Het
Mrps33 G A 6: 39,779,413 (GRCm39) P94L probably damaging Het
Ncapg2 G T 12: 116,414,033 (GRCm39) G1068C possibly damaging Het
Ndufaf7 C T 17: 79,249,546 (GRCm39) H148Y probably damaging Het
Nkx6-3 A T 8: 23,643,770 (GRCm39) D57V probably damaging Het
Nlrp1a T C 11: 70,983,150 (GRCm39) D1272G probably damaging Het
Oit3 T C 10: 59,265,392 (GRCm39) N291S probably damaging Het
Or1b1 A T 2: 36,995,181 (GRCm39) H160Q possibly damaging Het
Pld1 T G 3: 28,095,419 (GRCm39) S251A probably benign Het
Polr1h T A 17: 37,268,736 (GRCm39) L75F probably benign Het
Potefam3a C T 8: 20,356,948 (GRCm38) S254N unknown Het
Ppfibp1 T C 6: 146,921,001 (GRCm39) S580P probably benign Het
Prdx6b A T 2: 80,123,560 (GRCm39) D123V probably damaging Het
Ptprs A G 17: 56,731,256 (GRCm39) L1050P possibly damaging Het
Rcc1 A C 4: 132,065,110 (GRCm39) S138A probably damaging Het
Rimbp3 G T 16: 17,031,065 (GRCm39) R1496S possibly damaging Het
Sacs T C 14: 61,429,054 (GRCm39) V371A probably benign Het
Sfxn4 A G 19: 60,830,642 (GRCm39) L260P possibly damaging Het
Slc17a1 G A 13: 24,062,466 (GRCm39) S211N possibly damaging Het
Slc39a11 C T 11: 113,452,918 (GRCm39) V8M probably damaging Het
Smpd2 A G 10: 41,365,012 (GRCm39) I78T probably benign Het
Steap3 A C 1: 120,169,248 (GRCm39) F350V probably benign Het
Syt17 A T 7: 117,981,107 (GRCm39) V462E probably damaging Het
Tlr11 T A 14: 50,598,801 (GRCm39) D262E probably benign Het
Tnfrsf9 T C 4: 151,014,331 (GRCm39) V10A probably benign Het
Trpv3 C A 11: 73,168,800 (GRCm39) Q87K probably benign Het
Ugt1a5 T C 1: 88,094,281 (GRCm39) Y170H probably benign Het
Urb1 A G 16: 90,584,296 (GRCm39) L562P probably damaging Het
Usp3 G T 9: 66,437,537 (GRCm39) N299K probably benign Het
Vmn1r83 T C 7: 12,055,556 (GRCm39) Y167C probably damaging Het
Vmn2r117 T A 17: 23,694,539 (GRCm39) Y436F probably benign Het
Vps13d A G 4: 144,854,981 (GRCm39) I2220T Het
Zfp936 T A 7: 42,836,685 (GRCm39) V32D probably damaging Het
Zswim2 A G 2: 83,751,063 (GRCm39) C259R probably damaging Het
Other mutations in Meioc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Meioc APN 11 102,565,113 (GRCm39) missense probably benign 0.33
IGL01952:Meioc APN 11 102,563,011 (GRCm39) missense possibly damaging 0.79
IGL02006:Meioc APN 11 102,565,092 (GRCm39) missense probably damaging 1.00
IGL02195:Meioc APN 11 102,565,683 (GRCm39) missense possibly damaging 0.91
IGL02339:Meioc APN 11 102,559,274 (GRCm39) missense probably benign 0.18
IGL02935:Meioc APN 11 102,563,017 (GRCm39) missense probably benign 0.06
IGL03294:Meioc APN 11 102,571,495 (GRCm39) missense probably damaging 1.00
PIT4519001:Meioc UTSW 11 102,570,783 (GRCm39) missense probably damaging 1.00
R0285:Meioc UTSW 11 102,563,017 (GRCm39) missense probably benign 0.06
R0964:Meioc UTSW 11 102,570,857 (GRCm39) missense probably damaging 1.00
R1074:Meioc UTSW 11 102,566,219 (GRCm39) missense probably damaging 1.00
R2024:Meioc UTSW 11 102,566,184 (GRCm39) missense probably benign 0.00
R4012:Meioc UTSW 11 102,566,654 (GRCm39) missense probably damaging 0.99
R4429:Meioc UTSW 11 102,566,546 (GRCm39) missense probably damaging 1.00
R4491:Meioc UTSW 11 102,565,746 (GRCm39) missense possibly damaging 0.84
R4594:Meioc UTSW 11 102,564,992 (GRCm39) missense probably damaging 1.00
R4752:Meioc UTSW 11 102,565,259 (GRCm39) missense probably benign 0.00
R5301:Meioc UTSW 11 102,570,871 (GRCm39) missense probably damaging 1.00
R5352:Meioc UTSW 11 102,566,139 (GRCm39) missense probably benign 0.03
R5646:Meioc UTSW 11 102,566,083 (GRCm39) missense possibly damaging 0.94
R5958:Meioc UTSW 11 102,565,979 (GRCm39) missense probably benign 0.41
R5968:Meioc UTSW 11 102,566,657 (GRCm39) missense probably damaging 0.99
R6157:Meioc UTSW 11 102,559,227 (GRCm39) missense probably damaging 1.00
R6410:Meioc UTSW 11 102,565,860 (GRCm39) missense probably benign 0.00
R6644:Meioc UTSW 11 102,559,286 (GRCm39) critical splice donor site probably null
R7285:Meioc UTSW 11 102,557,168 (GRCm39) missense probably benign 0.00
R7815:Meioc UTSW 11 102,566,414 (GRCm39) missense probably damaging 1.00
R7984:Meioc UTSW 11 102,565,432 (GRCm39) missense possibly damaging 0.94
R8009:Meioc UTSW 11 102,567,569 (GRCm39) missense probably damaging 1.00
R8078:Meioc UTSW 11 102,559,226 (GRCm39) nonsense probably null
R8195:Meioc UTSW 11 102,565,893 (GRCm39) nonsense probably null
R8429:Meioc UTSW 11 102,565,032 (GRCm39) missense probably benign 0.06
R8797:Meioc UTSW 11 102,567,686 (GRCm39) nonsense probably null
R8854:Meioc UTSW 11 102,566,589 (GRCm39) missense probably damaging 0.98
R8891:Meioc UTSW 11 102,559,246 (GRCm39) missense probably benign 0.43
R9081:Meioc UTSW 11 102,565,001 (GRCm39) missense probably benign 0.00
R9360:Meioc UTSW 11 102,565,779 (GRCm39) missense probably benign 0.13
R9539:Meioc UTSW 11 102,565,506 (GRCm39) missense probably damaging 0.99
R9549:Meioc UTSW 11 102,556,550 (GRCm39) intron probably benign
R9751:Meioc UTSW 11 102,566,419 (GRCm39) nonsense probably null
Z1177:Meioc UTSW 11 102,557,190 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTGGCCAATGAACACAAGC -3'
(R):5'- ATGCTGTAATGGTGTTTCAAGACC -3'

Sequencing Primer
(F):5'- GCAGATTTGTAGATCACCATGACCTC -3'
(R):5'- CTTTCATGATATCAGACAGGCCAGTC -3'
Posted On 2019-10-07