Incidental Mutation 'R7440:Ccser2'
ID576917
Institutional Source Beutler Lab
Gene Symbol Ccser2
Ensembl Gene ENSMUSG00000058690
Gene Namecoiled-coil serine rich 2
Synonyms1700012P13Rik, 2900054P12Rik, Gcap14
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R7440 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location36874936-36968777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36898217 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 727 (K727E)
Ref Sequence ENSEMBL: ENSMUSP00000087478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067700] [ENSMUST00000090024] [ENSMUST00000182042] [ENSMUST00000182576] [ENSMUST00000182797] [ENSMUST00000183007] [ENSMUST00000183038] [ENSMUST00000183316]
Predicted Effect probably damaging
Transcript: ENSMUST00000067700
AA Change: K727E

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000068550
Gene: ENSMUSG00000058690
AA Change: K727E

DomainStartEndE-ValueType
low complexity region 50 63 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
coiled coil region 157 194 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000090024
AA Change: K727E

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087478
Gene: ENSMUSG00000058690
AA Change: K727E

DomainStartEndE-ValueType
low complexity region 389 412 N/A INTRINSIC
low complexity region 496 506 N/A INTRINSIC
low complexity region 543 562 N/A INTRINSIC
low complexity region 603 616 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
coiled coil region 710 747 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182042
AA Change: K155E

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138453
Gene: ENSMUSG00000058690
AA Change: K155E

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
coiled coil region 138 175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182576
SMART Domains Protein: ENSMUSP00000138318
Gene: ENSMUSG00000058690

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182797
AA Change: K155E

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138787
Gene: ENSMUSG00000058690
AA Change: K155E

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
coiled coil region 138 175 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183007
AA Change: K64E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000183038
AA Change: K174E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138718
Gene: ENSMUSG00000058690
AA Change: K174E

DomainStartEndE-ValueType
low complexity region 50 63 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
coiled coil region 157 194 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183316
AA Change: K95E

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138100
Gene: ENSMUSG00000058690
AA Change: K95E

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
coiled coil region 78 115 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik A G 9: 50,764,913 V35A probably benign Het
9230104L09Rik A C 2: 148,846,991 C109W probably damaging Het
Acadm G A 3: 153,922,989 T403I probably damaging Het
Adat1 A T 8: 111,989,898 M64K probably damaging Het
Adcy2 C T 13: 68,796,667 V199M probably damaging Het
Ankrd13a T C 5: 114,803,575 S508P possibly damaging Het
Ap1g1 T A 8: 109,802,724 probably null Het
Bicral C T 17: 46,825,784 G167R probably damaging Het
Cep350 T G 1: 155,940,772 K332N probably damaging Het
Chd5 A G 4: 152,384,651 N1811S probably benign Het
Chpf A T 1: 75,475,601 V565D probably damaging Het
Clcn6 A T 4: 148,014,195 L489H probably damaging Het
Cntln C A 4: 85,063,216 T877K possibly damaging Het
Cog4 T C 8: 110,879,706 V630A probably benign Het
Col6a5 G T 9: 105,881,431 S2192* probably null Het
Cry2 G A 2: 92,413,638 R397W probably damaging Het
Cyp1b1 T C 17: 79,713,557 N252S probably damaging Het
Dhx9 T C 1: 153,481,231 I91V probably benign Het
Dnajb6 G A 5: 29,757,859 A256T possibly damaging Het
Epm2a T G 10: 11,390,875 Y121* probably null Het
Erlec1 T C 11: 30,950,818 I117V possibly damaging Het
Exoc8 T C 8: 124,895,781 M616V probably benign Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Fuz T C 7: 44,896,572 L46P probably damaging Het
Gm15319 C T 8: 20,356,948 S254N unknown Het
Insc T C 7: 114,845,043 S422P possibly damaging Het
Intu A G 3: 40,697,551 I813V probably benign Het
Jak3 T A 8: 71,680,718 S352T probably benign Het
Klf11 T C 12: 24,655,491 S315P probably benign Het
Lrrc63 T C 14: 75,121,013 N400D possibly damaging Het
Lrrk1 T C 7: 66,290,854 D760G probably damaging Het
Macf1 A T 4: 123,455,446 L3976* probably null Het
Map7 C T 10: 20,261,859 A259V probably damaging Het
Meioc T A 11: 102,674,237 D170E possibly damaging Het
Mgat5b T A 11: 116,968,445 Y34* probably null Het
Mgst1 A G 6: 138,150,844 K68R probably benign Het
Miga1 T A 3: 152,338,046 probably null Het
Mrps33 G A 6: 39,802,479 P94L probably damaging Het
Ncapg2 G T 12: 116,450,413 G1068C possibly damaging Het
Ndufaf7 C T 17: 78,942,117 H148Y probably damaging Het
Nkx6-3 A T 8: 23,153,754 D57V probably damaging Het
Nlrp1a T C 11: 71,092,324 D1272G probably damaging Het
Oit3 T C 10: 59,429,570 N291S probably damaging Het
Olfr362 A T 2: 37,105,169 H160Q possibly damaging Het
Pld1 T G 3: 28,041,270 S251A probably benign Het
Ppfibp1 T C 6: 147,019,503 S580P probably benign Het
Prdx6b A T 2: 80,293,216 D123V probably damaging Het
Ptprs A G 17: 56,424,256 L1050P possibly damaging Het
Rcc1 A C 4: 132,337,799 S138A probably damaging Het
Rimbp3 G T 16: 17,213,201 R1496S possibly damaging Het
Sacs T C 14: 61,191,605 V371A probably benign Het
Sfxn4 A G 19: 60,842,204 L260P possibly damaging Het
Slc17a1 G A 13: 23,878,483 S211N possibly damaging Het
Slc39a11 C T 11: 113,562,092 V8M probably damaging Het
Smpd2 A G 10: 41,489,016 I78T probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Syt17 A T 7: 118,381,884 V462E probably damaging Het
Tlr11 T A 14: 50,361,344 D262E probably benign Het
Tnfrsf9 T C 4: 150,929,874 V10A probably benign Het
Trpv3 C A 11: 73,277,974 Q87K probably benign Het
Ugt1a5 T C 1: 88,166,559 Y170H probably benign Het
Urb1 A G 16: 90,787,408 L562P probably damaging Het
Usp3 G T 9: 66,530,255 N299K probably benign Het
Vmn1r83 T C 7: 12,321,629 Y167C probably damaging Het
Vmn2r117 T A 17: 23,475,565 Y436F probably benign Het
Vps13d A G 4: 145,128,411 I2220T Het
Zfp936 T A 7: 43,187,261 V32D probably damaging Het
Znrd1 T A 17: 36,957,844 L75F probably benign Het
Zswim2 A G 2: 83,920,719 C259R probably damaging Het
Other mutations in Ccser2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Ccser2 APN 14 36940064 missense probably damaging 1.00
IGL01285:Ccser2 APN 14 36938669 missense probably damaging 1.00
IGL01622:Ccser2 APN 14 36940963 missense probably benign 0.03
IGL01623:Ccser2 APN 14 36940963 missense probably benign 0.03
IGL02322:Ccser2 APN 14 36909129 missense probably damaging 1.00
IGL02342:Ccser2 APN 14 36918605 splice site probably benign
IGL02899:Ccser2 APN 14 36940759 missense probably benign 0.39
R0433:Ccser2 UTSW 14 36918529 missense probably damaging 1.00
R0543:Ccser2 UTSW 14 36940192 missense probably benign
R0674:Ccser2 UTSW 14 36918591 missense possibly damaging 0.94
R0853:Ccser2 UTSW 14 36940410 missense probably benign 0.18
R0964:Ccser2 UTSW 14 36909008 splice site probably benign
R1748:Ccser2 UTSW 14 36896313 missense probably damaging 1.00
R1748:Ccser2 UTSW 14 36896314 nonsense probably null
R1854:Ccser2 UTSW 14 36918591 missense possibly damaging 0.94
R2405:Ccser2 UTSW 14 36938669 missense probably damaging 1.00
R2926:Ccser2 UTSW 14 36879561 missense possibly damaging 0.91
R3846:Ccser2 UTSW 14 36940288 missense probably benign
R4298:Ccser2 UTSW 14 36890380 missense possibly damaging 0.63
R4701:Ccser2 UTSW 14 36938697 missense probably damaging 1.00
R4746:Ccser2 UTSW 14 36909125 missense probably damaging 1.00
R4888:Ccser2 UTSW 14 36940386 missense probably damaging 0.98
R4959:Ccser2 UTSW 14 36940796 missense probably benign 0.00
R5020:Ccser2 UTSW 14 36940177 missense probably benign 0.00
R5179:Ccser2 UTSW 14 36879351 missense possibly damaging 0.79
R5378:Ccser2 UTSW 14 36879434 missense possibly damaging 0.65
R6011:Ccser2 UTSW 14 36879575 missense probably benign 0.17
R6057:Ccser2 UTSW 14 36941165 missense probably damaging 0.98
R6180:Ccser2 UTSW 14 36940319 missense probably benign
R6216:Ccser2 UTSW 14 36940508 missense probably damaging 1.00
R6244:Ccser2 UTSW 14 36940718 missense probably benign 0.00
R6266:Ccser2 UTSW 14 36879675 missense probably damaging 1.00
R6730:Ccser2 UTSW 14 36879086 missense probably damaging 1.00
R6862:Ccser2 UTSW 14 36940081 missense probably benign
R7025:Ccser2 UTSW 14 36940007 missense probably damaging 1.00
R7076:Ccser2 UTSW 14 36939829 missense probably benign 0.14
R7092:Ccser2 UTSW 14 36940655 missense probably benign 0.03
R7353:Ccser2 UTSW 14 36941143 missense possibly damaging 0.91
R7509:Ccser2 UTSW 14 36938645 missense probably damaging 1.00
R7555:Ccser2 UTSW 14 36879500 missense possibly damaging 0.65
R7770:Ccser2 UTSW 14 36926874 missense probably damaging 1.00
R8103:Ccser2 UTSW 14 36896283 missense probably damaging 1.00
R8194:Ccser2 UTSW 14 36896263 missense probably damaging 1.00
R8356:Ccser2 UTSW 14 36890374 missense probably benign 0.00
R8456:Ccser2 UTSW 14 36890374 missense probably benign 0.00
X0066:Ccser2 UTSW 14 36940999 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAACACAATGCTACATGAACCTTC -3'
(R):5'- TCATAAGTGCTGACCCAGGG -3'

Sequencing Primer
(F):5'- TGCTACATGAACCTTCAAAAGTC -3'
(R):5'- GCAGTTGCCATTAGACCATG -3'
Posted On2019-10-07