Incidental Mutation 'R7440:Rimbp3'
ID 576921
Institutional Source Beutler Lab
Gene Symbol Rimbp3
Ensembl Gene ENSMUSG00000071636
Gene Name RIMS binding protein 3
Synonyms RIM-BP3, LOC239731, LOC385766
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock # R7440 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 17208603-17213982 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 17213201 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 1496 (R1496S)
Ref Sequence ENSEMBL: ENSMUSP00000127909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169803]
AlphaFold Q3V0F0
Predicted Effect possibly damaging
Transcript: ENSMUST00000169803
AA Change: R1496S

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127909
Gene: ENSMUSG00000071636
AA Change: R1496S

DomainStartEndE-ValueType
coiled coil region 25 56 N/A INTRINSIC
coiled coil region 84 145 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
coiled coil region 395 431 N/A INTRINSIC
coiled coil region 547 610 N/A INTRINSIC
low complexity region 688 701 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
SH3 825 888 7.58e-8 SMART
low complexity region 913 924 N/A INTRINSIC
FN3 980 1052 2.21e-3 SMART
FN3 1073 1160 1.91e1 SMART
low complexity region 1236 1243 N/A INTRINSIC
SH3 1423 1487 5.08e-2 SMART
SH3 1539 1602 5.97e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (69/69)
MGI Phenotype PHENOTYPE: Male mice homozygous for a null mutation display infertility with impaired spermiogenesis and defects in sperm head and flagellum morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik A G 9: 50,764,913 V35A probably benign Het
9230104L09Rik A C 2: 148,846,991 C109W probably damaging Het
Acadm G A 3: 153,922,989 T403I probably damaging Het
Adat1 A T 8: 111,989,898 M64K probably damaging Het
Adcy2 C T 13: 68,796,667 V199M probably damaging Het
Ankrd13a T C 5: 114,803,575 S508P possibly damaging Het
Ap1g1 T A 8: 109,802,724 probably null Het
Bicral C T 17: 46,825,784 G167R probably damaging Het
Ccser2 T C 14: 36,898,217 K727E possibly damaging Het
Cep350 T G 1: 155,940,772 K332N probably damaging Het
Chd5 A G 4: 152,384,651 N1811S probably benign Het
Chpf A T 1: 75,475,601 V565D probably damaging Het
Clcn6 A T 4: 148,014,195 L489H probably damaging Het
Cntln C A 4: 85,063,216 T877K possibly damaging Het
Cog4 T C 8: 110,879,706 V630A probably benign Het
Col6a5 G T 9: 105,881,431 S2192* probably null Het
Cry2 G A 2: 92,413,638 R397W probably damaging Het
Cyp1b1 T C 17: 79,713,557 N252S probably damaging Het
Dhx9 T C 1: 153,481,231 I91V probably benign Het
Dnajb6 G A 5: 29,757,859 A256T possibly damaging Het
Epm2a T G 10: 11,390,875 Y121* probably null Het
Erlec1 T C 11: 30,950,818 I117V possibly damaging Het
Exoc8 T C 8: 124,895,781 M616V probably benign Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Fuz T C 7: 44,896,572 L46P probably damaging Het
Gm15319 C T 8: 20,356,948 S254N unknown Het
Insc T C 7: 114,845,043 S422P possibly damaging Het
Intu A G 3: 40,697,551 I813V probably benign Het
Jak3 T A 8: 71,680,718 S352T probably benign Het
Klf11 T C 12: 24,655,491 S315P probably benign Het
Lrrc63 T C 14: 75,121,013 N400D possibly damaging Het
Lrrk1 T C 7: 66,290,854 D760G probably damaging Het
Macf1 A T 4: 123,455,446 L3976* probably null Het
Map7 C T 10: 20,261,859 A259V probably damaging Het
Meioc T A 11: 102,674,237 D170E possibly damaging Het
Mgat5b T A 11: 116,968,445 Y34* probably null Het
Mgst1 A G 6: 138,150,844 K68R probably benign Het
Miga1 T A 3: 152,338,046 probably null Het
Mrps33 G A 6: 39,802,479 P94L probably damaging Het
Ncapg2 G T 12: 116,450,413 G1068C possibly damaging Het
Ndufaf7 C T 17: 78,942,117 H148Y probably damaging Het
Nkx6-3 A T 8: 23,153,754 D57V probably damaging Het
Nlrp1a T C 11: 71,092,324 D1272G probably damaging Het
Oit3 T C 10: 59,429,570 N291S probably damaging Het
Olfr362 A T 2: 37,105,169 H160Q possibly damaging Het
Pld1 T G 3: 28,041,270 S251A probably benign Het
Ppfibp1 T C 6: 147,019,503 S580P probably benign Het
Prdx6b A T 2: 80,293,216 D123V probably damaging Het
Ptprs A G 17: 56,424,256 L1050P possibly damaging Het
Rcc1 A C 4: 132,337,799 S138A probably damaging Het
Sacs T C 14: 61,191,605 V371A probably benign Het
Sfxn4 A G 19: 60,842,204 L260P possibly damaging Het
Slc17a1 G A 13: 23,878,483 S211N possibly damaging Het
Slc39a11 C T 11: 113,562,092 V8M probably damaging Het
Smpd2 A G 10: 41,489,016 I78T probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Syt17 A T 7: 118,381,884 V462E probably damaging Het
Tlr11 T A 14: 50,361,344 D262E probably benign Het
Tnfrsf9 T C 4: 150,929,874 V10A probably benign Het
Trpv3 C A 11: 73,277,974 Q87K probably benign Het
Ugt1a5 T C 1: 88,166,559 Y170H probably benign Het
Urb1 A G 16: 90,787,408 L562P probably damaging Het
Usp3 G T 9: 66,530,255 N299K probably benign Het
Vmn1r83 T C 7: 12,321,629 Y167C probably damaging Het
Vmn2r117 T A 17: 23,475,565 Y436F probably benign Het
Vps13d A G 4: 145,128,411 I2220T Het
Zfp936 T A 7: 43,187,261 V32D probably damaging Het
Znrd1 T A 17: 36,957,844 L75F probably benign Het
Zswim2 A G 2: 83,920,719 C259R probably damaging Het
Other mutations in Rimbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rimbp3 APN 16 17209743 missense probably benign 0.01
IGL00786:Rimbp3 APN 16 17211688 missense probably damaging 0.99
IGL01411:Rimbp3 APN 16 17211094 missense probably damaging 1.00
IGL01434:Rimbp3 APN 16 17211702 missense probably benign 0.13
IGL01895:Rimbp3 APN 16 17211436 missense probably damaging 0.99
IGL02322:Rimbp3 APN 16 17211615 missense probably benign 0.00
IGL02649:Rimbp3 APN 16 17209608 nonsense probably null
IGL03285:Rimbp3 APN 16 17213232 missense probably benign 0.16
PIT4581001:Rimbp3 UTSW 16 17210716 missense possibly damaging 0.76
R0279:Rimbp3 UTSW 16 17209453 missense probably benign 0.00
R0465:Rimbp3 UTSW 16 17211780 missense possibly damaging 0.86
R0605:Rimbp3 UTSW 16 17211699 missense probably damaging 0.99
R0674:Rimbp3 UTSW 16 17212737 missense probably benign 0.02
R1676:Rimbp3 UTSW 16 17211113 missense probably benign 0.13
R1780:Rimbp3 UTSW 16 17212632 missense probably benign
R1946:Rimbp3 UTSW 16 17210427 missense probably benign 0.10
R2113:Rimbp3 UTSW 16 17209675 missense probably benign 0.00
R3847:Rimbp3 UTSW 16 17210299 missense probably benign 0.13
R3849:Rimbp3 UTSW 16 17210299 missense probably benign 0.13
R3850:Rimbp3 UTSW 16 17210299 missense probably benign 0.13
R4355:Rimbp3 UTSW 16 17209692 missense possibly damaging 0.56
R4646:Rimbp3 UTSW 16 17213098 missense probably damaging 0.99
R4669:Rimbp3 UTSW 16 17209189 missense possibly damaging 0.88
R4732:Rimbp3 UTSW 16 17210601 missense possibly damaging 0.94
R4733:Rimbp3 UTSW 16 17210601 missense possibly damaging 0.94
R5025:Rimbp3 UTSW 16 17209807 missense probably damaging 0.99
R5039:Rimbp3 UTSW 16 17213331 missense probably damaging 0.99
R5177:Rimbp3 UTSW 16 17209917 missense possibly damaging 0.85
R5311:Rimbp3 UTSW 16 17210844 missense probably benign 0.00
R5942:Rimbp3 UTSW 16 17211888 missense probably benign 0.00
R6063:Rimbp3 UTSW 16 17210917 missense probably damaging 1.00
R6092:Rimbp3 UTSW 16 17212270 missense probably damaging 1.00
R6126:Rimbp3 UTSW 16 17212276 missense probably benign 0.25
R6288:Rimbp3 UTSW 16 17212908 missense probably benign 0.22
R6446:Rimbp3 UTSW 16 17212929 missense probably benign 0.00
R6773:Rimbp3 UTSW 16 17209015 missense probably damaging 1.00
R7017:Rimbp3 UTSW 16 17209746 missense probably benign 0.04
R7043:Rimbp3 UTSW 16 17211108 missense probably damaging 1.00
R7048:Rimbp3 UTSW 16 17210326 missense probably benign 0.20
R7378:Rimbp3 UTSW 16 17211204 missense probably benign
R7788:Rimbp3 UTSW 16 17212704 missense probably benign 0.00
R7879:Rimbp3 UTSW 16 17211046 missense possibly damaging 0.71
R8071:Rimbp3 UTSW 16 17210863 missense probably benign
R8272:Rimbp3 UTSW 16 17209105 missense possibly damaging 0.85
R8419:Rimbp3 UTSW 16 17213022 missense probably damaging 0.97
R8819:Rimbp3 UTSW 16 17210907 missense probably benign 0.17
R8830:Rimbp3 UTSW 16 17209006 missense probably damaging 0.98
R8936:Rimbp3 UTSW 16 17213020 missense probably benign
R8982:Rimbp3 UTSW 16 17209647 missense probably benign 0.11
R9365:Rimbp3 UTSW 16 17208756 missense possibly damaging 0.93
Z1176:Rimbp3 UTSW 16 17209474 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTCAACTCAGAAGCTGCAGAAG -3'
(R):5'- ACAGGCCCATAAACTGTGAC -3'

Sequencing Primer
(F):5'- CAGAAGAAGAGCTGGCCTTCC -3'
(R):5'- AGCTCTCAATACCAGCTTGC -3'
Posted On 2019-10-07