Mutagenetix > Incidental Mutation

Incidental Mutation 'R7440:Urb1'

576922

Institutional Source

Beutler Lab

Gene Symbol

Urb1

Ensembl Gene

ENSMUSG00000039929

Gene Name

URB1 ribosome biogenesis 1 homolog (S. cerevisiae)

Synonyms

4921511H13Rik, 5730405K23Rik

MMRRC Submission

045516-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7440 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

90751527-90810413 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 90787408 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 562 (L562P)

Ref Sequence

ENSEMBL: ENSMUSP00000114717 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000140920]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000140920
AA Change: L562P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114717
Gene: ENSMUSG00000039929
AA Change: L562P

Domain	Start	End	E-Value	Type
low complexity region	8	20	N/A	INTRINSIC
Pfam:Npa1	78	396	1.5e-86	PFAM
low complexity region	751	761	N/A	INTRINSIC
low complexity region	955	966	N/A	INTRINSIC
low complexity region	1126	1137	N/A	INTRINSIC
low complexity region	1360	1375	N/A	INTRINSIC
Pfam:NopRA1	1670	1859	3.6e-60	PFAM
low complexity region	2029	2040	N/A	INTRINSIC
low complexity region	2092	2111	N/A	INTRINSIC

Meta Mutation Damage Score

0.5797

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (69/69)

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110032A03Rik	A	G	9: 50,764,913	V35A	probably benign	Het
9230104L09Rik	A	C	2: 148,846,991	C109W	probably damaging	Het
Acadm	G	A	3: 153,922,989	T403I	probably damaging	Het
Adat1	A	T	8: 111,989,898	M64K	probably damaging	Het
Adcy2	C	T	13: 68,796,667	V199M	probably damaging	Het
Ankrd13a	T	C	5: 114,803,575	S508P	possibly damaging	Het
Ap1g1	T	A	8: 109,802,724		probably null	Het
Bicral	C	T	17: 46,825,784	G167R	probably damaging	Het
Ccser2	T	C	14: 36,898,217	K727E	possibly damaging	Het
Cep350	T	G	1: 155,940,772	K332N	probably damaging	Het
Chd5	A	G	4: 152,384,651	N1811S	probably benign	Het
Chpf	A	T	1: 75,475,601	V565D	probably damaging	Het
Clcn6	A	T	4: 148,014,195	L489H	probably damaging	Het
Cntln	C	A	4: 85,063,216	T877K	possibly damaging	Het
Cog4	T	C	8: 110,879,706	V630A	probably benign	Het
Col6a5	G	T	9: 105,881,431	S2192*	probably null	Het
Cry2	G	A	2: 92,413,638	R397W	probably damaging	Het
Cyp1b1	T	C	17: 79,713,557	N252S	probably damaging	Het
Dhx9	T	C	1: 153,481,231	I91V	probably benign	Het
Dnajb6	G	A	5: 29,757,859	A256T	possibly damaging	Het
Epm2a	T	G	10: 11,390,875	Y121*	probably null	Het
Erlec1	T	C	11: 30,950,818	I117V	possibly damaging	Het
Exoc8	T	C	8: 124,895,781	M616V	probably benign	Het
Fmn1	A	T	2: 113,441,611	Q108L	unknown	Het
Fuz	T	C	7: 44,896,572	L46P	probably damaging	Het
Gm15319	C	T	8: 20,356,948	S254N	unknown	Het
Insc	T	C	7: 114,845,043	S422P	possibly damaging	Het
Intu	A	G	3: 40,697,551	I813V	probably benign	Het
Jak3	T	A	8: 71,680,718	S352T	probably benign	Het
Klf11	T	C	12: 24,655,491	S315P	probably benign	Het
Lrrc63	T	C	14: 75,121,013	N400D	possibly damaging	Het
Lrrk1	T	C	7: 66,290,854	D760G	probably damaging	Het
Macf1	A	T	4: 123,455,446	L3976*	probably null	Het
Map7	C	T	10: 20,261,859	A259V	probably damaging	Het
Meioc	T	A	11: 102,674,237	D170E	possibly damaging	Het
Mgat5b	T	A	11: 116,968,445	Y34*	probably null	Het
Mgst1	A	G	6: 138,150,844	K68R	probably benign	Het
Miga1	T	A	3: 152,338,046		probably null	Het
Mrps33	G	A	6: 39,802,479	P94L	probably damaging	Het
Ncapg2	G	T	12: 116,450,413	G1068C	possibly damaging	Het
Ndufaf7	C	T	17: 78,942,117	H148Y	probably damaging	Het
Nkx6-3	A	T	8: 23,153,754	D57V	probably damaging	Het
Nlrp1a	T	C	11: 71,092,324	D1272G	probably damaging	Het
Oit3	T	C	10: 59,429,570	N291S	probably damaging	Het
Olfr362	A	T	2: 37,105,169	H160Q	possibly damaging	Het
Pld1	T	G	3: 28,041,270	S251A	probably benign	Het
Ppfibp1	T	C	6: 147,019,503	S580P	probably benign	Het
Prdx6b	A	T	2: 80,293,216	D123V	probably damaging	Het
Ptprs	A	G	17: 56,424,256	L1050P	possibly damaging	Het
Rcc1	A	C	4: 132,337,799	S138A	probably damaging	Het
Rimbp3	G	T	16: 17,213,201	R1496S	possibly damaging	Het
Sacs	T	C	14: 61,191,605	V371A	probably benign	Het
Sfxn4	A	G	19: 60,842,204	L260P	possibly damaging	Het
Slc17a1	G	A	13: 23,878,483	S211N	possibly damaging	Het
Slc39a11	C	T	11: 113,562,092	V8M	probably damaging	Het
Smpd2	A	G	10: 41,489,016	I78T	probably benign	Het
Steap3	A	C	1: 120,241,518	F350V	probably benign	Het
Syt17	A	T	7: 118,381,884	V462E	probably damaging	Het
Tlr11	T	A	14: 50,361,344	D262E	probably benign	Het
Tnfrsf9	T	C	4: 150,929,874	V10A	probably benign	Het
Trpv3	C	A	11: 73,277,974	Q87K	probably benign	Het
Ugt1a5	T	C	1: 88,166,559	Y170H	probably benign	Het
Usp3	G	T	9: 66,530,255	N299K	probably benign	Het
Vmn1r83	T	C	7: 12,321,629	Y167C	probably damaging	Het
Vmn2r117	T	A	17: 23,475,565	Y436F	probably benign	Het
Vps13d	A	G	4: 145,128,411	I2220T		Het
Zfp936	T	A	7: 43,187,261	V32D	probably damaging	Het
Znrd1	T	A	17: 36,957,844	L75F	probably benign	Het
Zswim2	A	G	2: 83,920,719	C259R	probably damaging	Het

Other mutations in Urb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00715:Urb1	APN	16	90753321	critical splice donor site	probably null
IGL00915:Urb1	APN	16	90779098	missense	possibly damaging	0.76
IGL01108:Urb1	APN	16	90792814	missense	probably damaging	1.00
IGL01122:Urb1	APN	16	90804458	missense	possibly damaging	0.81
IGL01387:Urb1	APN	16	90757761	missense	possibly damaging	0.64
IGL01484:Urb1	APN	16	90777560	missense	probably benign	0.11
IGL01606:Urb1	APN	16	90760459	missense	probably damaging	1.00
IGL01989:Urb1	APN	16	90769586	splice site	probably benign
IGL02516:Urb1	APN	16	90772695	missense	possibly damaging	0.49
IGL03018:Urb1	APN	16	90788156	missense	probably benign	0.02
IGL03165:Urb1	APN	16	90780304	missense	probably damaging	1.00
IGL03216:Urb1	APN	16	90788114	missense	probably benign	0.00
H8562:Urb1	UTSW	16	90769469	missense	probably benign	0.08
H8786:Urb1	UTSW	16	90769469	missense	probably benign	0.08
R0064:Urb1	UTSW	16	90779140	missense	probably benign
R0064:Urb1	UTSW	16	90779140	missense	probably benign
R0359:Urb1	UTSW	16	90791160	missense	probably damaging	1.00
R0386:Urb1	UTSW	16	90796399	missense	probably damaging	1.00
R0508:Urb1	UTSW	16	90783262	splice site	probably benign
R0517:Urb1	UTSW	16	90777422	nonsense	probably null
R0704:Urb1	UTSW	16	90776207	missense	probably benign	0.31
R0755:Urb1	UTSW	16	90774094	missense	probably damaging	1.00
R0755:Urb1	UTSW	16	90779138	missense	probably benign
R0783:Urb1	UTSW	16	90810297	missense	possibly damaging	0.55
R0833:Urb1	UTSW	16	90795448	missense	possibly damaging	0.89
R0836:Urb1	UTSW	16	90795448	missense	possibly damaging	0.89
R0970:Urb1	UTSW	16	90769447	missense	possibly damaging	0.83
R1144:Urb1	UTSW	16	90776318	splice site	probably null
R1344:Urb1	UTSW	16	90769466	missense	probably damaging	1.00
R1418:Urb1	UTSW	16	90769466	missense	probably damaging	1.00
R1453:Urb1	UTSW	16	90796492	missense	probably damaging	1.00
R1470:Urb1	UTSW	16	90752014	missense	probably benign	0.34
R1470:Urb1	UTSW	16	90752014	missense	probably benign	0.34
R1520:Urb1	UTSW	16	90774745	missense	probably benign	0.00
R1521:Urb1	UTSW	16	90753863	missense	probably damaging	1.00
R1598:Urb1	UTSW	16	90777440	missense	possibly damaging	0.93
R1617:Urb1	UTSW	16	90760452	missense	possibly damaging	0.82
R1625:Urb1	UTSW	16	90774048	critical splice donor site	probably null
R1640:Urb1	UTSW	16	90772626	missense	probably benign	0.00
R1664:Urb1	UTSW	16	90788082	critical splice donor site	probably null
R1672:Urb1	UTSW	16	90787397	missense	probably damaging	1.00
R1694:Urb1	UTSW	16	90767040	missense	probably benign
R1856:Urb1	UTSW	16	90761695	missense	probably benign	0.00
R2001:Urb1	UTSW	16	90762344	missense	probably benign	0.30
R2196:Urb1	UTSW	16	90774256	missense	probably benign	0.01
R2850:Urb1	UTSW	16	90774256	missense	probably benign	0.01
R3009:Urb1	UTSW	16	90774798	missense	probably benign	0.09
R3104:Urb1	UTSW	16	90795443	missense	probably damaging	1.00
R3105:Urb1	UTSW	16	90795443	missense	probably damaging	1.00
R3106:Urb1	UTSW	16	90795443	missense	probably damaging	1.00
R3160:Urb1	UTSW	16	90797903	missense	probably damaging	1.00
R3162:Urb1	UTSW	16	90797903	missense	probably damaging	1.00
R3900:Urb1	UTSW	16	90783376	missense	possibly damaging	0.86
R4014:Urb1	UTSW	16	90769465	missense	probably damaging	1.00
R4036:Urb1	UTSW	16	90788086	missense	probably benign
R4332:Urb1	UTSW	16	90774537	missense	probably damaging	1.00
R4448:Urb1	UTSW	16	90769394	missense	possibly damaging	0.71
R4581:Urb1	UTSW	16	90788146	missense	probably benign	0.04
R4593:Urb1	UTSW	16	90787444	missense	probably damaging	1.00
R4610:Urb1	UTSW	16	90776271	missense	probably benign	0.43
R4659:Urb1	UTSW	16	90776129	missense	probably damaging	0.96
R4672:Urb1	UTSW	16	90772634	missense	probably benign
R4681:Urb1	UTSW	16	90804537	missense	probably damaging	0.99
R4771:Urb1	UTSW	16	90753518	missense	probably benign	0.00
R4790:Urb1	UTSW	16	90769555	nonsense	probably null
R4798:Urb1	UTSW	16	90757827	missense	probably benign	0.12
R4809:Urb1	UTSW	16	90759842	missense	possibly damaging	0.82
R4850:Urb1	UTSW	16	90795414	nonsense	probably null
R4916:Urb1	UTSW	16	90783328	missense	probably damaging	1.00
R4969:Urb1	UTSW	16	90805411	missense	probably damaging	1.00
R5032:Urb1	UTSW	16	90756171	missense	probably benign	0.00
R5111:Urb1	UTSW	16	90752017	missense	probably benign	0.00
R5122:Urb1	UTSW	16	90752095	nonsense	probably null
R5184:Urb1	UTSW	16	90783274	critical splice donor site	probably null
R5199:Urb1	UTSW	16	90792748	missense	possibly damaging	0.95
R5436:Urb1	UTSW	16	90792762	missense	probably damaging	1.00
R5767:Urb1	UTSW	16	90776163	missense	probably benign	0.00
R5812:Urb1	UTSW	16	90804537	missense	probably damaging	0.99
R5872:Urb1	UTSW	16	90772764	nonsense	probably null
R6052:Urb1	UTSW	16	90762383	missense	probably damaging	1.00
R6063:Urb1	UTSW	16	90789097	missense	probably benign	0.02
R6065:Urb1	UTSW	16	90803332	missense	probably benign	0.03
R6181:Urb1	UTSW	16	90779094	missense	probably benign	0.00
R6268:Urb1	UTSW	16	90753919	missense	probably benign	0.03
R6429:Urb1	UTSW	16	90762430	splice site	probably null
R6572:Urb1	UTSW	16	90787414	missense	probably benign	0.37
R6606:Urb1	UTSW	16	90810268	missense	probably benign	0.00
R6730:Urb1	UTSW	16	90779083	missense	possibly damaging	0.89
R6838:Urb1	UTSW	16	90782106	missense	possibly damaging	0.93
R7237:Urb1	UTSW	16	90791166	missense	probably damaging	1.00
R7238:Urb1	UTSW	16	90752115	missense	possibly damaging	0.88
R7339:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7341:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7361:Urb1	UTSW	16	90774768	missense	probably damaging	0.99
R7365:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7366:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7530:Urb1	UTSW	16	90761634	missense	probably damaging	1.00
R7553:Urb1	UTSW	16	90792864	missense	probably damaging	1.00
R7557:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7603:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7607:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7609:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7610:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7612:Urb1	UTSW	16	90797910	missense	probably damaging	1.00
R7613:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7684:Urb1	UTSW	16	90786118	nonsense	probably null
R8029:Urb1	UTSW	16	90779152	missense	possibly damaging	0.67
R8324:Urb1	UTSW	16	90791190	missense	probably damaging	1.00
R8680:Urb1	UTSW	16	90774625	missense	probably benign	0.00
R8785:Urb1	UTSW	16	90803423	missense	probably benign	0.07
R8914:Urb1	UTSW	16	90810234	missense	probably damaging	1.00
R8959:Urb1	UTSW	16	90774117	missense	probably benign	0.26
R9005:Urb1	UTSW	16	90753790	missense	probably benign	0.01
R9126:Urb1	UTSW	16	90769402	missense	possibly damaging	0.53
R9195:Urb1	UTSW	16	90792750	missense	probably benign	0.03
R9276:Urb1	UTSW	16	90772575	splice site	probably benign
R9534:Urb1	UTSW	16	90786208	missense	possibly damaging	0.54
Z1177:Urb1	UTSW	16	90753883	missense	probably benign	0.00
Z1177:Urb1	UTSW	16	90774862	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- GATCCTCAGCTCCTAGACTCTG -3'
(R):5'- GAAGGCTTAAGACCAGTCCCTG -3'

Sequencing Primer
(F):5'- AGCTCCTAGACTCTGCTGCAG -3'
(R):5'- TGTTAGCACACTGGCCCTGAAG -3'

Posted On

2019-10-07