Incidental Mutation 'R7440:Urb1'
ID576922
Institutional Source Beutler Lab
Gene Symbol Urb1
Ensembl Gene ENSMUSG00000039929
Gene NameURB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Synonyms4921511H13Rik, 5730405K23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7440 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location90751527-90810413 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90787408 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 562 (L562P)
Ref Sequence ENSEMBL: ENSMUSP00000114717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140920]
Predicted Effect probably damaging
Transcript: ENSMUST00000140920
AA Change: L562P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114717
Gene: ENSMUSG00000039929
AA Change: L562P

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:Npa1 78 396 1.5e-86 PFAM
low complexity region 751 761 N/A INTRINSIC
low complexity region 955 966 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
low complexity region 1360 1375 N/A INTRINSIC
Pfam:NopRA1 1670 1859 3.6e-60 PFAM
low complexity region 2029 2040 N/A INTRINSIC
low complexity region 2092 2111 N/A INTRINSIC
Meta Mutation Damage Score 0.5797 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik A G 9: 50,764,913 V35A probably benign Het
9230104L09Rik A C 2: 148,846,991 C109W probably damaging Het
Acadm G A 3: 153,922,989 T403I probably damaging Het
Adat1 A T 8: 111,989,898 M64K probably damaging Het
Adcy2 C T 13: 68,796,667 V199M probably damaging Het
Ankrd13a T C 5: 114,803,575 S508P possibly damaging Het
Ap1g1 T A 8: 109,802,724 probably null Het
Bicral C T 17: 46,825,784 G167R probably damaging Het
Ccser2 T C 14: 36,898,217 K727E possibly damaging Het
Cep350 T G 1: 155,940,772 K332N probably damaging Het
Chd5 A G 4: 152,384,651 N1811S probably benign Het
Chpf A T 1: 75,475,601 V565D probably damaging Het
Clcn6 A T 4: 148,014,195 L489H probably damaging Het
Cntln C A 4: 85,063,216 T877K possibly damaging Het
Cog4 T C 8: 110,879,706 V630A probably benign Het
Col6a5 G T 9: 105,881,431 S2192* probably null Het
Cry2 G A 2: 92,413,638 R397W probably damaging Het
Cyp1b1 T C 17: 79,713,557 N252S probably damaging Het
Dhx9 T C 1: 153,481,231 I91V probably benign Het
Dnajb6 G A 5: 29,757,859 A256T possibly damaging Het
Epm2a T G 10: 11,390,875 Y121* probably null Het
Erlec1 T C 11: 30,950,818 I117V possibly damaging Het
Exoc8 T C 8: 124,895,781 M616V probably benign Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Fuz T C 7: 44,896,572 L46P probably damaging Het
Gm15319 C T 8: 20,356,948 S254N unknown Het
Insc T C 7: 114,845,043 S422P possibly damaging Het
Intu A G 3: 40,697,551 I813V probably benign Het
Jak3 T A 8: 71,680,718 S352T probably benign Het
Klf11 T C 12: 24,655,491 S315P probably benign Het
Lrrc63 T C 14: 75,121,013 N400D possibly damaging Het
Lrrk1 T C 7: 66,290,854 D760G probably damaging Het
Macf1 A T 4: 123,455,446 L3976* probably null Het
Map7 C T 10: 20,261,859 A259V probably damaging Het
Meioc T A 11: 102,674,237 D170E possibly damaging Het
Mgat5b T A 11: 116,968,445 Y34* probably null Het
Mgst1 A G 6: 138,150,844 K68R probably benign Het
Miga1 T A 3: 152,338,046 probably null Het
Mrps33 G A 6: 39,802,479 P94L probably damaging Het
Ncapg2 G T 12: 116,450,413 G1068C possibly damaging Het
Ndufaf7 C T 17: 78,942,117 H148Y probably damaging Het
Nkx6-3 A T 8: 23,153,754 D57V probably damaging Het
Nlrp1a T C 11: 71,092,324 D1272G probably damaging Het
Oit3 T C 10: 59,429,570 N291S probably damaging Het
Olfr362 A T 2: 37,105,169 H160Q possibly damaging Het
Pld1 T G 3: 28,041,270 S251A probably benign Het
Ppfibp1 T C 6: 147,019,503 S580P probably benign Het
Prdx6b A T 2: 80,293,216 D123V probably damaging Het
Ptprs A G 17: 56,424,256 L1050P possibly damaging Het
Rcc1 A C 4: 132,337,799 S138A probably damaging Het
Rimbp3 G T 16: 17,213,201 R1496S possibly damaging Het
Sacs T C 14: 61,191,605 V371A probably benign Het
Sfxn4 A G 19: 60,842,204 L260P possibly damaging Het
Slc17a1 G A 13: 23,878,483 S211N possibly damaging Het
Slc39a11 C T 11: 113,562,092 V8M probably damaging Het
Smpd2 A G 10: 41,489,016 I78T probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Syt17 A T 7: 118,381,884 V462E probably damaging Het
Tlr11 T A 14: 50,361,344 D262E probably benign Het
Tnfrsf9 T C 4: 150,929,874 V10A probably benign Het
Trpv3 C A 11: 73,277,974 Q87K probably benign Het
Ugt1a5 T C 1: 88,166,559 Y170H probably benign Het
Usp3 G T 9: 66,530,255 N299K probably benign Het
Vmn1r83 T C 7: 12,321,629 Y167C probably damaging Het
Vmn2r117 T A 17: 23,475,565 Y436F probably benign Het
Vps13d A G 4: 145,128,411 I2220T Het
Zfp936 T A 7: 43,187,261 V32D probably damaging Het
Znrd1 T A 17: 36,957,844 L75F probably benign Het
Zswim2 A G 2: 83,920,719 C259R probably damaging Het
Other mutations in Urb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Urb1 APN 16 90753321 critical splice donor site probably null
IGL00915:Urb1 APN 16 90779098 missense possibly damaging 0.76
IGL01108:Urb1 APN 16 90792814 missense probably damaging 1.00
IGL01122:Urb1 APN 16 90804458 missense possibly damaging 0.81
IGL01387:Urb1 APN 16 90757761 missense possibly damaging 0.64
IGL01484:Urb1 APN 16 90777560 missense probably benign 0.11
IGL01606:Urb1 APN 16 90760459 missense probably damaging 1.00
IGL01989:Urb1 APN 16 90769586 splice site probably benign
IGL02516:Urb1 APN 16 90772695 missense possibly damaging 0.49
IGL03018:Urb1 APN 16 90788156 missense probably benign 0.02
IGL03165:Urb1 APN 16 90780304 missense probably damaging 1.00
IGL03216:Urb1 APN 16 90788114 missense probably benign 0.00
H8562:Urb1 UTSW 16 90769469 missense probably benign 0.08
H8786:Urb1 UTSW 16 90769469 missense probably benign 0.08
R0064:Urb1 UTSW 16 90779140 missense probably benign
R0064:Urb1 UTSW 16 90779140 missense probably benign
R0359:Urb1 UTSW 16 90791160 missense probably damaging 1.00
R0386:Urb1 UTSW 16 90796399 missense probably damaging 1.00
R0508:Urb1 UTSW 16 90783262 splice site probably benign
R0517:Urb1 UTSW 16 90777422 nonsense probably null
R0704:Urb1 UTSW 16 90776207 missense probably benign 0.31
R0755:Urb1 UTSW 16 90774094 missense probably damaging 1.00
R0755:Urb1 UTSW 16 90779138 missense probably benign
R0783:Urb1 UTSW 16 90810297 missense possibly damaging 0.55
R0833:Urb1 UTSW 16 90795448 missense possibly damaging 0.89
R0836:Urb1 UTSW 16 90795448 missense possibly damaging 0.89
R0970:Urb1 UTSW 16 90769447 missense possibly damaging 0.83
R1144:Urb1 UTSW 16 90776318 splice site probably null
R1344:Urb1 UTSW 16 90769466 missense probably damaging 1.00
R1418:Urb1 UTSW 16 90769466 missense probably damaging 1.00
R1453:Urb1 UTSW 16 90796492 missense probably damaging 1.00
R1470:Urb1 UTSW 16 90752014 missense probably benign 0.34
R1470:Urb1 UTSW 16 90752014 missense probably benign 0.34
R1520:Urb1 UTSW 16 90774745 missense probably benign 0.00
R1521:Urb1 UTSW 16 90753863 missense probably damaging 1.00
R1598:Urb1 UTSW 16 90777440 missense possibly damaging 0.93
R1617:Urb1 UTSW 16 90760452 missense possibly damaging 0.82
R1625:Urb1 UTSW 16 90774048 critical splice donor site probably null
R1640:Urb1 UTSW 16 90772626 missense probably benign 0.00
R1664:Urb1 UTSW 16 90788082 critical splice donor site probably null
R1672:Urb1 UTSW 16 90787397 missense probably damaging 1.00
R1694:Urb1 UTSW 16 90767040 missense probably benign
R1856:Urb1 UTSW 16 90761695 missense probably benign 0.00
R2001:Urb1 UTSW 16 90762344 missense probably benign 0.30
R2196:Urb1 UTSW 16 90774256 missense probably benign 0.01
R2850:Urb1 UTSW 16 90774256 missense probably benign 0.01
R3009:Urb1 UTSW 16 90774798 missense probably benign 0.09
R3104:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3105:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3106:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3160:Urb1 UTSW 16 90797903 missense probably damaging 1.00
R3162:Urb1 UTSW 16 90797903 missense probably damaging 1.00
R3900:Urb1 UTSW 16 90783376 missense possibly damaging 0.86
R4014:Urb1 UTSW 16 90769465 missense probably damaging 1.00
R4036:Urb1 UTSW 16 90788086 missense probably benign
R4332:Urb1 UTSW 16 90774537 missense probably damaging 1.00
R4448:Urb1 UTSW 16 90769394 missense possibly damaging 0.71
R4581:Urb1 UTSW 16 90788146 missense probably benign 0.04
R4593:Urb1 UTSW 16 90787444 missense probably damaging 1.00
R4610:Urb1 UTSW 16 90776271 missense probably benign 0.43
R4659:Urb1 UTSW 16 90776129 missense probably damaging 0.96
R4672:Urb1 UTSW 16 90772634 missense probably benign
R4681:Urb1 UTSW 16 90804537 missense probably damaging 0.99
R4771:Urb1 UTSW 16 90753518 missense probably benign 0.00
R4790:Urb1 UTSW 16 90769555 nonsense probably null
R4798:Urb1 UTSW 16 90757827 missense probably benign 0.12
R4809:Urb1 UTSW 16 90759842 missense possibly damaging 0.82
R4850:Urb1 UTSW 16 90795414 nonsense probably null
R4916:Urb1 UTSW 16 90783328 missense probably damaging 1.00
R4969:Urb1 UTSW 16 90805411 missense probably damaging 1.00
R5032:Urb1 UTSW 16 90756171 missense probably benign 0.00
R5111:Urb1 UTSW 16 90752017 missense probably benign 0.00
R5122:Urb1 UTSW 16 90752095 nonsense probably null
R5184:Urb1 UTSW 16 90783274 critical splice donor site probably null
R5199:Urb1 UTSW 16 90792748 missense possibly damaging 0.95
R5436:Urb1 UTSW 16 90792762 missense probably damaging 1.00
R5767:Urb1 UTSW 16 90776163 missense probably benign 0.00
R5812:Urb1 UTSW 16 90804537 missense probably damaging 0.99
R5872:Urb1 UTSW 16 90772764 nonsense probably null
R6052:Urb1 UTSW 16 90762383 missense probably damaging 1.00
R6063:Urb1 UTSW 16 90789097 missense probably benign 0.02
R6065:Urb1 UTSW 16 90803332 missense probably benign 0.03
R6181:Urb1 UTSW 16 90779094 missense probably benign 0.00
R6268:Urb1 UTSW 16 90753919 missense probably benign 0.03
R6429:Urb1 UTSW 16 90762430 splice site probably null
R6572:Urb1 UTSW 16 90787414 missense probably benign 0.37
R6606:Urb1 UTSW 16 90810268 missense probably benign 0.00
R6730:Urb1 UTSW 16 90779083 missense possibly damaging 0.89
R6838:Urb1 UTSW 16 90782106 missense possibly damaging 0.93
R7237:Urb1 UTSW 16 90791166 missense probably damaging 1.00
R7238:Urb1 UTSW 16 90752115 missense possibly damaging 0.88
R7339:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7341:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7361:Urb1 UTSW 16 90774768 missense probably damaging 0.99
R7365:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7366:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7530:Urb1 UTSW 16 90761634 missense probably damaging 1.00
R7553:Urb1 UTSW 16 90792864 missense probably damaging 1.00
R7557:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7603:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7607:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7609:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7610:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7612:Urb1 UTSW 16 90797910 missense probably damaging 1.00
R7613:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7684:Urb1 UTSW 16 90786118 nonsense probably null
R8029:Urb1 UTSW 16 90779152 missense possibly damaging 0.67
R8324:Urb1 UTSW 16 90791190 missense probably damaging 1.00
Z1177:Urb1 UTSW 16 90753883 missense probably benign 0.00
Z1177:Urb1 UTSW 16 90774862 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GATCCTCAGCTCCTAGACTCTG -3'
(R):5'- GAAGGCTTAAGACCAGTCCCTG -3'

Sequencing Primer
(F):5'- AGCTCCTAGACTCTGCTGCAG -3'
(R):5'- TGTTAGCACACTGGCCCTGAAG -3'
Posted On2019-10-07