Incidental Mutation 'R7441:1700007K13Rik'
ID576937
Institutional Source Beutler Lab
Gene Symbol 1700007K13Rik
Ensembl Gene ENSMUSG00000026831
Gene NameRIKEN cDNA 1700007K13 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7441 (G1)
Quality Score178.458
Status Not validated
Chromosome2
Chromosomal Location28462001-28466332 bp(-) (GRCm38)
Type of Mutationsmall deletion (14 aa in frame mutation)
DNA Base Change (assembly) TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC to TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC at 28466110 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038600] [ENSMUST00000086370] [ENSMUST00000127683]
Predicted Effect probably benign
Transcript: ENSMUST00000038600
SMART Domains Protein: ENSMUSP00000036725
Gene: ENSMUSG00000035772

DomainStartEndE-ValueType
Pfam:Ribosomal_S2 81 182 4.6e-23 PFAM
Pfam:Ribosomal_S2 180 257 7.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086370
SMART Domains Protein: ENSMUSP00000083557
Gene: ENSMUSG00000026831

DomainStartEndE-ValueType
Pfam:DUF4490 35 137 1.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127683
SMART Domains Protein: ENSMUSP00000116111
Gene: ENSMUSG00000026831

DomainStartEndE-ValueType
Pfam:DUF4490 33 122 1.5e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit severe laterality defects, including situs inversus totalis and heterotaxy with randomized situs and left and right isomerisms. Homozygous embryos with isomerisms die in utero due to associated cardiovascular malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A C 2: 151,472,925 S278A possibly damaging Het
Adamts20 T C 15: 94,353,673 D411G probably damaging Het
Adgrl3 A G 5: 81,724,140 I894V possibly damaging Het
Adprhl1 C T 8: 13,223,069 V1230I probably benign Het
Agpat1 T A 17: 34,610,909 Y77N probably damaging Het
Anpep A G 7: 79,827,644 V725A possibly damaging Het
Apc T A 18: 34,312,073 I674K probably damaging Het
Arhgef2 A G 3: 88,643,955 R808G probably damaging Het
Asap1 A G 15: 64,130,256 V402A probably damaging Het
Aspg T C 12: 112,124,821 V479A possibly damaging Het
B3galnt2 G A 13: 13,994,485 V368M probably benign Het
Bahcc1 T C 11: 120,286,306 S2007P probably damaging Het
Cyfip2 A T 11: 46,196,427 I1212N possibly damaging Het
Dnajc16 A T 4: 141,763,813 D675E probably damaging Het
Dram2 T C 3: 106,555,187 F4L probably damaging Het
Dsp A G 13: 38,195,449 T2057A probably benign Het
Dync1h1 T G 12: 110,636,453 L2176R probably damaging Het
Efhb A T 17: 53,401,521 I707N possibly damaging Het
Eif2ak4 A G 2: 118,471,896 T1555A probably benign Het
Erc1 G A 6: 119,824,951 T35I possibly damaging Het
Esr2 C A 12: 76,141,394 M363I probably benign Het
Etl4 A T 2: 20,744,189 N446I possibly damaging Het
Evpl T A 11: 116,222,956 K1303* probably null Het
Fam129c A G 8: 71,600,164 D94G probably benign Het
Fam135b A T 15: 71,463,680 V555E probably damaging Het
Fam186b A G 15: 99,280,089 L452P probably benign Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Gcc2 A G 10: 58,256,901 T48A probably benign Het
Gm12169 G A 11: 46,528,555 W66* probably null Het
Gm6619 T G 6: 131,490,391 I73S possibly damaging Het
Gm8267 T A 14: 44,722,940 D116V probably damaging Het
Gtf3c3 G A 1: 54,420,448 T385M probably benign Het
Iqgap2 C A 13: 95,628,076 M1553I probably benign Het
Kcnk1 G T 8: 125,995,568 G37C probably damaging Het
Kifc3 T C 8: 95,137,987 M32V probably benign Het
Krt81 C A 15: 101,461,370 K222N possibly damaging Het
Lrrc63 A G 14: 75,126,257 S145P possibly damaging Het
Mybbp1a T A 11: 72,451,275 V1279E probably benign Het
Olfr1044 T A 2: 86,171,010 D269V probably damaging Het
Olfr742 A T 14: 50,515,396 Y64F probably damaging Het
Pramef8 A G 4: 143,418,840 Y293C probably benign Het
Ptpn18 T C 1: 34,473,335 V407A probably benign Het
Ptpn9 T A 9: 57,027,433 Y160* probably null Het
Ptprj T C 2: 90,449,819 K1045R possibly damaging Het
Rundc3a G T 11: 102,400,046 probably null Het
Scn11a C T 9: 119,758,626 V1351I probably benign Het
Slc26a9 A G 1: 131,762,818 Y520C probably damaging Het
Spata20 G A 11: 94,484,041 A245V probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Swt1 A T 1: 151,411,064 F226I probably benign Het
Taar7f A G 10: 24,049,987 T160A possibly damaging Het
Upf2 A T 2: 6,018,932 I698F unknown Het
Vmn2r84 T C 10: 130,392,113 T85A possibly damaging Het
Zfp426 T C 9: 20,470,851 E280G possibly damaging Het
Zfp810 C A 9: 22,279,272 E78* probably null Het
Zfp937 GTGATAAGGCATTTGCACAAAACAGTCATCTCCTAACACATAAAAGAACACAT G 2: 150,238,710 probably null Het
Other mutations in 1700007K13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02732:1700007K13Rik APN 2 28465180 missense probably damaging 0.97
R0423:1700007K13Rik UTSW 2 28466024 splice site probably benign
R0604:1700007K13Rik UTSW 2 28466091 missense possibly damaging 0.55
R6580:1700007K13Rik UTSW 2 28466050 missense probably damaging 1.00
R6819:1700007K13Rik UTSW 2 28466110 small deletion probably benign
R7292:1700007K13Rik UTSW 2 28466110 small deletion probably benign
R7351:1700007K13Rik UTSW 2 28466110 small deletion probably benign
R7569:1700007K13Rik UTSW 2 28466110 small deletion probably benign
R7620:1700007K13Rik UTSW 2 28466110 small deletion probably benign
R7802:1700007K13Rik UTSW 2 28466110 small deletion probably benign
R7898:1700007K13Rik UTSW 2 28466110 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AAGGTTCATGACTGGCTCC -3'
(R):5'- CAGCAGGCACAGACTTGATC -3'

Sequencing Primer
(F):5'- CTTTTGACCTCAGTAGCCACAG -3'
(R):5'- AGACTTGATCTGGGCTAGTTTCC -3'
Posted On2019-10-07