Incidental Mutation 'R7441:Fmn1'
ID576940
Institutional Source Beutler Lab
Gene Symbol Fmn1
Ensembl Gene ENSMUSG00000044042
Gene Nameformin 1
SynonymsFmn, formin-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R7441 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location113327736-113716767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 113441611 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 108 (Q108L)
Ref Sequence ENSEMBL: ENSMUSP00000080093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081349] [ENSMUST00000099576] [ENSMUST00000102547] [ENSMUST00000161731]
PDB Structure
FBP28WW2 domain in complex with the PPLIPPPP peptide [SOLUTION NMR]
FBP28WW2 domain in complex with PTPPPLPP peptide [SOLUTION NMR]
FBP28WW2 domain in complex with a PPPLIPPPP peptide [SOLUTION NMR]
Predicted Effect unknown
Transcript: ENSMUST00000081349
AA Change: Q108L
SMART Domains Protein: ENSMUSP00000080093
Gene: ENSMUSG00000044042
AA Change: Q108L

DomainStartEndE-ValueType
Blast:FH2 25 641 N/A BLAST
SCOP:d1jvr__ 668 699 2e-3 SMART
FH2 757 1162 1.16e-137 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099576
SMART Domains Protein: ENSMUSP00000097171
Gene: ENSMUSG00000044042

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1388 1.16e-137 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102547
SMART Domains Protein: ENSMUSP00000099606
Gene: ENSMUSG00000044042

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1424 1.03e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161731
SMART Domains Protein: ENSMUSP00000125052
Gene: ENSMUSG00000044042

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 619 1e-62 BLAST
Blast:FH2 625 765 3e-53 BLAST
SCOP:d1jvr__ 796 827 2e-3 SMART
FH2 885 1290 1.16e-137 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the formin homology family and encodes a protein that has a role in the formation of adherens junction and the polymerization of linear actin cables. The homologous gene in mouse is associated with limb deformity. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous, irradiation-induced, and transgene-insertional mutations show severe syndactyly and oligodactyly of the feet, abnormal long bones (including radius-ulna fusions), and reduced or absent kidneys. Many mutants survive and breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
4921509C19Rik A C 2: 151,472,925 S278A possibly damaging Het
Adamts20 T C 15: 94,353,673 D411G probably damaging Het
Adgrl3 A G 5: 81,724,140 I894V possibly damaging Het
Adprhl1 C T 8: 13,223,069 V1230I probably benign Het
Agpat1 T A 17: 34,610,909 Y77N probably damaging Het
Anpep A G 7: 79,827,644 V725A possibly damaging Het
Apc T A 18: 34,312,073 I674K probably damaging Het
Arhgef2 A G 3: 88,643,955 R808G probably damaging Het
Asap1 A G 15: 64,130,256 V402A probably damaging Het
Aspg T C 12: 112,124,821 V479A possibly damaging Het
B3galnt2 G A 13: 13,994,485 V368M probably benign Het
Bahcc1 T C 11: 120,286,306 S2007P probably damaging Het
Cyfip2 A T 11: 46,196,427 I1212N possibly damaging Het
Dnajc16 A T 4: 141,763,813 D675E probably damaging Het
Dram2 T C 3: 106,555,187 F4L probably damaging Het
Dsp A G 13: 38,195,449 T2057A probably benign Het
Dync1h1 T G 12: 110,636,453 L2176R probably damaging Het
Efhb A T 17: 53,401,521 I707N possibly damaging Het
Eif2ak4 A G 2: 118,471,896 T1555A probably benign Het
Erc1 G A 6: 119,824,951 T35I possibly damaging Het
Esr2 C A 12: 76,141,394 M363I probably benign Het
Etl4 A T 2: 20,744,189 N446I possibly damaging Het
Evpl T A 11: 116,222,956 K1303* probably null Het
Fam129c A G 8: 71,600,164 D94G probably benign Het
Fam135b A T 15: 71,463,680 V555E probably damaging Het
Fam186b A G 15: 99,280,089 L452P probably benign Het
Gcc2 A G 10: 58,256,901 T48A probably benign Het
Gm12169 G A 11: 46,528,555 W66* probably null Het
Gm6619 T G 6: 131,490,391 I73S possibly damaging Het
Gm8267 T A 14: 44,722,940 D116V probably damaging Het
Gtf3c3 G A 1: 54,420,448 T385M probably benign Het
Iqgap2 C A 13: 95,628,076 M1553I probably benign Het
Kcnk1 G T 8: 125,995,568 G37C probably damaging Het
Kifc3 T C 8: 95,137,987 M32V probably benign Het
Krt81 C A 15: 101,461,370 K222N possibly damaging Het
Lrrc63 A G 14: 75,126,257 S145P possibly damaging Het
Mybbp1a T A 11: 72,451,275 V1279E probably benign Het
Olfr1044 T A 2: 86,171,010 D269V probably damaging Het
Olfr742 A T 14: 50,515,396 Y64F probably damaging Het
Pramef8 A G 4: 143,418,840 Y293C probably benign Het
Ptpn18 T C 1: 34,473,335 V407A probably benign Het
Ptpn9 T A 9: 57,027,433 Y160* probably null Het
Ptprj T C 2: 90,449,819 K1045R possibly damaging Het
Rundc3a G T 11: 102,400,046 probably null Het
Scn11a C T 9: 119,758,626 V1351I probably benign Het
Slc26a9 A G 1: 131,762,818 Y520C probably damaging Het
Spata20 G A 11: 94,484,041 A245V probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Swt1 A T 1: 151,411,064 F226I probably benign Het
Taar7f A G 10: 24,049,987 T160A possibly damaging Het
Upf2 A T 2: 6,018,932 I698F unknown Het
Vmn2r84 T C 10: 130,392,113 T85A possibly damaging Het
Zfp426 T C 9: 20,470,851 E280G possibly damaging Het
Zfp810 C A 9: 22,279,272 E78* probably null Het
Zfp937 GTGATAAGGCATTTGCACAAAACAGTCATCTCCTAACACATAAAAGAACACAT G 2: 150,238,710 probably null Het
Other mutations in Fmn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Fmn1 APN 2 113444467 intron probably benign
IGL01520:Fmn1 APN 2 113444368 intron probably benign
IGL02039:Fmn1 APN 2 113365080 missense unknown
IGL02222:Fmn1 APN 2 113593109 missense probably damaging 1.00
IGL02238:Fmn1 APN 2 113582125 missense possibly damaging 0.90
IGL02373:Fmn1 APN 2 113364126 missense unknown
IGL02490:Fmn1 APN 2 113529472 splice site probably benign
IGL02506:Fmn1 APN 2 113525295 missense unknown
IGL02684:Fmn1 APN 2 113525277 missense unknown
IGL03008:Fmn1 APN 2 113365100 missense unknown
IGL03058:Fmn1 APN 2 113441814 intron probably benign
IGL03076:Fmn1 APN 2 113584092 missense probably damaging 0.99
FR4304:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4304:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4342:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525773 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525778 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525781 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525784 small insertion probably benign
R0349:Fmn1 UTSW 2 113365796 missense unknown
R0452:Fmn1 UTSW 2 113636779 missense possibly damaging 0.46
R0529:Fmn1 UTSW 2 113707853 splice site probably benign
R1215:Fmn1 UTSW 2 113693030 nonsense probably null
R1471:Fmn1 UTSW 2 113693094 missense possibly damaging 0.95
R1489:Fmn1 UTSW 2 113365212 missense unknown
R1491:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R1551:Fmn1 UTSW 2 113525862 missense possibly damaging 0.70
R1558:Fmn1 UTSW 2 113693118 missense possibly damaging 0.46
R1588:Fmn1 UTSW 2 113365698 missense unknown
R1602:Fmn1 UTSW 2 113525623 missense unknown
R1690:Fmn1 UTSW 2 113525482 missense unknown
R1772:Fmn1 UTSW 2 113365355 missense unknown
R1867:Fmn1 UTSW 2 113709438 missense probably damaging 1.00
R1923:Fmn1 UTSW 2 113429721 intron probably benign
R1941:Fmn1 UTSW 2 113365143 missense unknown
R2019:Fmn1 UTSW 2 113364480 missense unknown
R2140:Fmn1 UTSW 2 113595048 missense probably benign 0.45
R2164:Fmn1 UTSW 2 113365617 missense unknown
R2395:Fmn1 UTSW 2 113365181 missense unknown
R2999:Fmn1 UTSW 2 113365094 missense unknown
R3405:Fmn1 UTSW 2 113364348 missense unknown
R3407:Fmn1 UTSW 2 113365055 missense unknown
R3771:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3772:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3773:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3777:Fmn1 UTSW 2 113365122 missense unknown
R4166:Fmn1 UTSW 2 113636735 missense probably benign 0.33
R4477:Fmn1 UTSW 2 113444399 intron probably benign
R4614:Fmn1 UTSW 2 113365149 missense unknown
R4701:Fmn1 UTSW 2 113584071 missense possibly damaging 0.76
R4867:Fmn1 UTSW 2 113584120 critical splice donor site probably null
R5063:Fmn1 UTSW 2 113364921 missense unknown
R5224:Fmn1 UTSW 2 113365125 missense unknown
R5510:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R6083:Fmn1 UTSW 2 113364303 missense unknown
R6234:Fmn1 UTSW 2 113365655 missense unknown
R6266:Fmn1 UTSW 2 113596338 missense probably damaging 1.00
R6764:Fmn1 UTSW 2 113525215 missense unknown
R7054:Fmn1 UTSW 2 113365008 missense unknown
R7311:Fmn1 UTSW 2 113525680 missense unknown
R7439:Fmn1 UTSW 2 113441611 missense unknown
R7440:Fmn1 UTSW 2 113441611 missense unknown
R7444:Fmn1 UTSW 2 113441611 missense unknown
R7461:Fmn1 UTSW 2 113364071 missense unknown
R7526:Fmn1 UTSW 2 113688134 missense probably damaging 0.99
R7540:Fmn1 UTSW 2 113529310 splice site probably null
R7576:Fmn1 UTSW 2 113365008 missense unknown
R7657:Fmn1 UTSW 2 113525193 missense unknown
R7669:Fmn1 UTSW 2 113365477 missense unknown
R7713:Fmn1 UTSW 2 113525814 missense unknown
R7841:Fmn1 UTSW 2 113529465 critical splice donor site probably null
R7924:Fmn1 UTSW 2 113529465 critical splice donor site probably null
R8041:Fmn1 UTSW 2 113364594 missense unknown
RF003:Fmn1 UTSW 2 113525786 small insertion probably benign
RF023:Fmn1 UTSW 2 113525786 small insertion probably benign
Z1088:Fmn1 UTSW 2 113441925 intron probably benign
Predicted Primers PCR Primer
(F):5'- ACTCCTTGGAGCCTGAAGAG -3'
(R):5'- TGGGCTCTTGAGAAGGTTCAC -3'

Sequencing Primer
(F):5'- CCTGAAGAGGAAGATGCTGTGC -3'
(R):5'- GGCTCTTGAGAAGGTTCACATAAAAC -3'
Posted On2019-10-07