Incidental Mutation 'R7441:Dnajc16'
ID 576946
Institutional Source Beutler Lab
Gene Symbol Dnajc16
Ensembl Gene ENSMUSG00000040697
Gene Name DnaJ heat shock protein family (Hsp40) member C16
Synonyms 2900037O03Rik, 4732437J24Rik
MMRRC Submission 045517-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.772) question?
Stock # R7441 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 141487500-141518242 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 141491124 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 675 (D675E)
Ref Sequence ENSEMBL: ENSMUSP00000048714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038014] [ENSMUST00000038161]
AlphaFold Q80TN4
PDB Structure Solution structure of the J domain of the pseudo DnaJ protein, mouse hypothetical mKIAA0962 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000038014
AA Change: D675E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048714
Gene: ENSMUSG00000040697
AA Change: D675E

DomainStartEndE-ValueType
DnaJ 28 85 4.5e-30 SMART
Pfam:Thioredoxin 142 243 4.4e-8 PFAM
low complexity region 537 549 N/A INTRINSIC
low complexity region 730 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038161
SMART Domains Protein: ENSMUSP00000040853
Gene: ENSMUSG00000040706

DomainStartEndE-ValueType
low complexity region 44 62 N/A INTRINSIC
Pfam:Arginase 77 351 9.8e-85 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A C 2: 151,314,845 (GRCm39) S278A possibly damaging Het
Adamts20 T C 15: 94,251,554 (GRCm39) D411G probably damaging Het
Adgrl3 A G 5: 81,871,987 (GRCm39) I894V possibly damaging Het
Adprhl1 C T 8: 13,273,069 (GRCm39) V1230I probably benign Het
Agpat1 T A 17: 34,829,883 (GRCm39) Y77N probably damaging Het
Anpep A G 7: 79,477,392 (GRCm39) V725A possibly damaging Het
Apc T A 18: 34,445,126 (GRCm39) I674K probably damaging Het
Arhgef2 A G 3: 88,551,262 (GRCm39) R808G probably damaging Het
Asap1 A G 15: 64,002,105 (GRCm39) V402A probably damaging Het
Aspg T C 12: 112,091,255 (GRCm39) V479A possibly damaging Het
B3galnt2 G A 13: 14,169,070 (GRCm39) V368M probably benign Het
Bahcc1 T C 11: 120,177,132 (GRCm39) S2007P probably damaging Het
Cyfip2 A T 11: 46,087,254 (GRCm39) I1212N possibly damaging Het
Dram2 T C 3: 106,462,503 (GRCm39) F4L probably damaging Het
Dsp A G 13: 38,379,425 (GRCm39) T2057A probably benign Het
Dync1h1 T G 12: 110,602,887 (GRCm39) L2176R probably damaging Het
Efhb A T 17: 53,708,549 (GRCm39) I707N possibly damaging Het
Eif2ak4 A G 2: 118,302,377 (GRCm39) T1555A probably benign Het
Erc1 G A 6: 119,801,912 (GRCm39) T35I possibly damaging Het
Esr2 C A 12: 76,188,168 (GRCm39) M363I probably benign Het
Etl4 A T 2: 20,749,000 (GRCm39) N446I possibly damaging Het
Evpl T A 11: 116,113,782 (GRCm39) K1303* probably null Het
Fam135b A T 15: 71,335,529 (GRCm39) V555E probably damaging Het
Fam186b A G 15: 99,177,970 (GRCm39) L452P probably benign Het
Fmn1 A T 2: 113,271,956 (GRCm39) Q108L unknown Het
Gcc2 A G 10: 58,092,723 (GRCm39) T48A probably benign Het
Gm6619 T G 6: 131,467,354 (GRCm39) I73S possibly damaging Het
Gm8267 T A 14: 44,960,397 (GRCm39) D116V probably damaging Het
Gtf3c3 G A 1: 54,459,607 (GRCm39) T385M probably benign Het
Iqgap2 C A 13: 95,764,584 (GRCm39) M1553I probably benign Het
Kcnk1 G T 8: 126,722,307 (GRCm39) G37C probably damaging Het
Kifc3 T C 8: 95,864,615 (GRCm39) M32V probably benign Het
Krt81 C A 15: 101,359,251 (GRCm39) K222N possibly damaging Het
Lrrc63 A G 14: 75,363,697 (GRCm39) S145P possibly damaging Het
Mybbp1a T A 11: 72,342,101 (GRCm39) V1279E probably benign Het
Niban3 A G 8: 72,052,808 (GRCm39) D94G probably benign Het
Or11g26 A T 14: 50,752,853 (GRCm39) Y64F probably damaging Het
Or8u9 T A 2: 86,001,354 (GRCm39) D269V probably damaging Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,356,122 (GRCm39) probably benign Het
Pramel12 A G 4: 143,145,410 (GRCm39) Y293C probably benign Het
Ptpn18 T C 1: 34,512,416 (GRCm39) V407A probably benign Het
Ptpn9 T A 9: 56,934,717 (GRCm39) Y160* probably null Het
Ptprj T C 2: 90,280,163 (GRCm39) K1045R possibly damaging Het
Rundc3a G T 11: 102,290,872 (GRCm39) probably null Het
Scn11a C T 9: 119,587,692 (GRCm39) V1351I probably benign Het
Slc26a9 A G 1: 131,690,556 (GRCm39) Y520C probably damaging Het
Spata20 G A 11: 94,374,867 (GRCm39) A245V probably benign Het
Steap3 A C 1: 120,169,248 (GRCm39) F350V probably benign Het
Swt1 A T 1: 151,286,815 (GRCm39) F226I probably benign Het
Taar7f A G 10: 23,925,885 (GRCm39) T160A possibly damaging Het
Timd5 G A 11: 46,419,382 (GRCm39) W66* probably null Het
Upf2 A T 2: 6,023,743 (GRCm39) I698F unknown Het
Vmn2r84 T C 10: 130,227,982 (GRCm39) T85A possibly damaging Het
Zfp426 T C 9: 20,382,147 (GRCm39) E280G possibly damaging Het
Zfp810 C A 9: 22,190,568 (GRCm39) E78* probably null Het
Zfp937 GTGATAAGGCATTTGCACAAAACAGTCATCTCCTAACACATAAAAGAACACAT G 2: 150,080,630 (GRCm39) probably null Het
Other mutations in Dnajc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dnajc16 APN 4 141,490,874 (GRCm39) splice site probably null
IGL00840:Dnajc16 APN 4 141,495,314 (GRCm39) missense probably damaging 1.00
IGL01503:Dnajc16 APN 4 141,491,008 (GRCm39) missense possibly damaging 0.65
IGL01919:Dnajc16 APN 4 141,501,940 (GRCm39) missense probably benign 0.06
IGL02065:Dnajc16 APN 4 141,504,244 (GRCm39) missense probably damaging 1.00
IGL02544:Dnajc16 APN 4 141,491,958 (GRCm39) missense probably damaging 1.00
IGL03028:Dnajc16 APN 4 141,495,043 (GRCm39) nonsense probably null
PIT4418001:Dnajc16 UTSW 4 141,498,260 (GRCm39) missense probably damaging 0.99
PIT4585001:Dnajc16 UTSW 4 141,491,996 (GRCm39) missense probably damaging 1.00
R0071:Dnajc16 UTSW 4 141,495,318 (GRCm39) missense probably benign
R0415:Dnajc16 UTSW 4 141,516,359 (GRCm39) nonsense probably null
R0532:Dnajc16 UTSW 4 141,516,320 (GRCm39) missense probably damaging 1.00
R1418:Dnajc16 UTSW 4 141,495,052 (GRCm39) nonsense probably null
R2959:Dnajc16 UTSW 4 141,493,856 (GRCm39) nonsense probably null
R3025:Dnajc16 UTSW 4 141,501,922 (GRCm39) missense probably benign
R3796:Dnajc16 UTSW 4 141,495,048 (GRCm39) missense probably benign
R3854:Dnajc16 UTSW 4 141,490,964 (GRCm39) nonsense probably null
R3856:Dnajc16 UTSW 4 141,490,964 (GRCm39) nonsense probably null
R4661:Dnajc16 UTSW 4 141,490,859 (GRCm39) missense probably damaging 1.00
R4841:Dnajc16 UTSW 4 141,501,936 (GRCm39) missense probably damaging 1.00
R4842:Dnajc16 UTSW 4 141,501,936 (GRCm39) missense probably damaging 1.00
R5116:Dnajc16 UTSW 4 141,495,280 (GRCm39) nonsense probably null
R5126:Dnajc16 UTSW 4 141,501,820 (GRCm39) missense probably benign 0.01
R5140:Dnajc16 UTSW 4 141,491,994 (GRCm39) missense possibly damaging 0.85
R5275:Dnajc16 UTSW 4 141,495,239 (GRCm39) missense possibly damaging 0.82
R5295:Dnajc16 UTSW 4 141,495,239 (GRCm39) missense possibly damaging 0.82
R5891:Dnajc16 UTSW 4 141,502,703 (GRCm39) missense probably benign
R6888:Dnajc16 UTSW 4 141,504,303 (GRCm39) missense probably benign 0.24
R7062:Dnajc16 UTSW 4 141,494,001 (GRCm39) missense probably damaging 1.00
R7684:Dnajc16 UTSW 4 141,501,879 (GRCm39) missense probably benign 0.02
R8843:Dnajc16 UTSW 4 141,492,002 (GRCm39) missense possibly damaging 0.87
R8924:Dnajc16 UTSW 4 141,494,018 (GRCm39) nonsense probably null
R9005:Dnajc16 UTSW 4 141,491,945 (GRCm39) missense possibly damaging 0.95
R9053:Dnajc16 UTSW 4 141,510,371 (GRCm39) missense probably benign 0.28
R9550:Dnajc16 UTSW 4 141,495,058 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTGCTCAGCTTGCCTTTGAG -3'
(R):5'- TTTCGTAAGTCCAGGCTGCAG -3'

Sequencing Primer
(F):5'- GCCAAGGCCACAGGAAG -3'
(R):5'- GGCTCTCTGGCTGTTCAGC -3'
Posted On 2019-10-07