Incidental Mutation 'R7441:Zfp426'
ID576956
Institutional Source Beutler Lab
Gene Symbol Zfp426
Ensembl Gene ENSMUSG00000059475
Gene Namezinc finger protein 426
SynonymsZfo61, Zfp68-rs1, 2900057C04Rik, KRAB1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R7441 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location20468549-20492746 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20470851 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 280 (E280G)
Ref Sequence ENSEMBL: ENSMUSP00000127045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080386] [ENSMUST00000115562] [ENSMUST00000163348] [ENSMUST00000163427] [ENSMUST00000164799] [ENSMUST00000164825] [ENSMUST00000166005] [ENSMUST00000167457] [ENSMUST00000168095] [ENSMUST00000169269] [ENSMUST00000169558]
Predicted Effect probably damaging
Transcript: ENSMUST00000080386
AA Change: E266G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079250
Gene: ENSMUSG00000059475
AA Change: E266G

DomainStartEndE-ValueType
KRAB 39 99 5.56e-31 SMART
ZnF_C2H2 219 241 2.12e-4 SMART
ZnF_C2H2 274 296 1.69e-3 SMART
ZnF_C2H2 302 324 8.81e-2 SMART
ZnF_C2H2 330 352 5.59e-4 SMART
ZnF_C2H2 358 380 3.16e-3 SMART
ZnF_C2H2 386 408 1.43e-1 SMART
ZnF_C2H2 414 436 1.79e-2 SMART
ZnF_C2H2 442 464 1.22e-4 SMART
ZnF_C2H2 470 492 1.38e-3 SMART
ZnF_C2H2 498 520 3.58e-2 SMART
ZnF_C2H2 528 550 3.44e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115562
AA Change: E266G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111224
Gene: ENSMUSG00000059475
AA Change: E266G

DomainStartEndE-ValueType
KRAB 39 99 5.56e-31 SMART
ZnF_C2H2 219 241 2.12e-4 SMART
ZnF_C2H2 274 296 1.69e-3 SMART
ZnF_C2H2 302 324 8.81e-2 SMART
ZnF_C2H2 330 352 5.59e-4 SMART
ZnF_C2H2 358 380 3.16e-3 SMART
ZnF_C2H2 386 408 1.43e-1 SMART
ZnF_C2H2 414 436 1.79e-2 SMART
ZnF_C2H2 442 464 1.22e-4 SMART
ZnF_C2H2 470 492 1.38e-3 SMART
ZnF_C2H2 498 520 3.58e-2 SMART
ZnF_C2H2 528 550 3.44e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163348
AA Change: E265G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126446
Gene: ENSMUSG00000059475
AA Change: E265G

DomainStartEndE-ValueType
KRAB 39 99 5.56e-31 SMART
ZnF_C2H2 218 240 2.12e-4 SMART
ZnF_C2H2 273 295 1.69e-3 SMART
ZnF_C2H2 301 323 8.81e-2 SMART
ZnF_C2H2 329 351 5.59e-4 SMART
ZnF_C2H2 357 379 3.16e-3 SMART
ZnF_C2H2 385 407 1.43e-1 SMART
ZnF_C2H2 413 435 1.79e-2 SMART
ZnF_C2H2 441 463 1.22e-4 SMART
ZnF_C2H2 469 491 1.38e-3 SMART
ZnF_C2H2 497 519 3.58e-2 SMART
ZnF_C2H2 527 549 3.44e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163427
Predicted Effect probably benign
Transcript: ENSMUST00000164799
SMART Domains Protein: ENSMUSP00000130120
Gene: ENSMUSG00000059475

DomainStartEndE-ValueType
KRAB 53 93 1.2e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164825
SMART Domains Protein: ENSMUSP00000127914
Gene: ENSMUSG00000059475

DomainStartEndE-ValueType
KRAB 39 99 5.56e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166005
AA Change: E266G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129727
Gene: ENSMUSG00000059475
AA Change: E266G

DomainStartEndE-ValueType
KRAB 39 99 5.56e-31 SMART
ZnF_C2H2 219 241 2.12e-4 SMART
ZnF_C2H2 274 296 1.69e-3 SMART
ZnF_C2H2 302 324 8.81e-2 SMART
ZnF_C2H2 330 352 5.59e-4 SMART
ZnF_C2H2 358 380 3.16e-3 SMART
ZnF_C2H2 386 408 1.43e-1 SMART
ZnF_C2H2 414 436 1.79e-2 SMART
ZnF_C2H2 442 464 1.22e-4 SMART
ZnF_C2H2 470 492 1.38e-3 SMART
ZnF_C2H2 498 520 3.58e-2 SMART
ZnF_C2H2 528 550 3.44e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167457
AA Change: E199G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130945
Gene: ENSMUSG00000059475
AA Change: E199G

DomainStartEndE-ValueType
KRAB 1 32 1.46e0 SMART
ZnF_C2H2 152 174 2.12e-4 SMART
ZnF_C2H2 207 229 1.69e-3 SMART
ZnF_C2H2 235 257 8.81e-2 SMART
ZnF_C2H2 263 285 5.59e-4 SMART
ZnF_C2H2 291 313 3.16e-3 SMART
ZnF_C2H2 319 341 1.43e-1 SMART
ZnF_C2H2 347 369 1.79e-2 SMART
ZnF_C2H2 375 397 1.22e-4 SMART
ZnF_C2H2 403 425 1.38e-3 SMART
ZnF_C2H2 431 453 3.58e-2 SMART
ZnF_C2H2 461 483 3.44e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168095
SMART Domains Protein: ENSMUSP00000130309
Gene: ENSMUSG00000059475

DomainStartEndE-ValueType
KRAB 39 83 1.37e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169269
SMART Domains Protein: ENSMUSP00000128843
Gene: ENSMUSG00000059475

DomainStartEndE-ValueType
KRAB 39 69 7.16e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169558
AA Change: E280G

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127045
Gene: ENSMUSG00000059475
AA Change: E280G

DomainStartEndE-ValueType
KRAB 53 113 5.56e-31 SMART
ZnF_C2H2 233 255 2.12e-4 SMART
ZnF_C2H2 288 310 1.69e-3 SMART
ZnF_C2H2 316 338 8.81e-2 SMART
ZnF_C2H2 344 366 5.59e-4 SMART
ZnF_C2H2 372 394 3.16e-3 SMART
ZnF_C2H2 400 422 1.43e-1 SMART
ZnF_C2H2 428 450 1.79e-2 SMART
ZnF_C2H2 456 478 1.22e-4 SMART
ZnF_C2H2 484 506 1.38e-3 SMART
ZnF_C2H2 512 534 3.58e-2 SMART
ZnF_C2H2 542 564 3.44e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kaposi's sarcoma-associated herpesvirus (KSHV) can be reactivated from latency by the viral protein RTA. The protein encoded by this gene is a zinc finger transcriptional repressor that interacts with RTA to modulate RTA-mediated reactivation of KSHV. While the encoded protein can repress KSHV reactivation, RTA can induce degradation of this protein through the ubiquitin-proteasome pathway to overcome the repression. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
4921509C19Rik A C 2: 151,472,925 S278A possibly damaging Het
Adamts20 T C 15: 94,353,673 D411G probably damaging Het
Adgrl3 A G 5: 81,724,140 I894V possibly damaging Het
Adprhl1 C T 8: 13,223,069 V1230I probably benign Het
Agpat1 T A 17: 34,610,909 Y77N probably damaging Het
Anpep A G 7: 79,827,644 V725A possibly damaging Het
Apc T A 18: 34,312,073 I674K probably damaging Het
Arhgef2 A G 3: 88,643,955 R808G probably damaging Het
Asap1 A G 15: 64,130,256 V402A probably damaging Het
Aspg T C 12: 112,124,821 V479A possibly damaging Het
B3galnt2 G A 13: 13,994,485 V368M probably benign Het
Bahcc1 T C 11: 120,286,306 S2007P probably damaging Het
Cyfip2 A T 11: 46,196,427 I1212N possibly damaging Het
Dnajc16 A T 4: 141,763,813 D675E probably damaging Het
Dram2 T C 3: 106,555,187 F4L probably damaging Het
Dsp A G 13: 38,195,449 T2057A probably benign Het
Dync1h1 T G 12: 110,636,453 L2176R probably damaging Het
Efhb A T 17: 53,401,521 I707N possibly damaging Het
Eif2ak4 A G 2: 118,471,896 T1555A probably benign Het
Erc1 G A 6: 119,824,951 T35I possibly damaging Het
Esr2 C A 12: 76,141,394 M363I probably benign Het
Etl4 A T 2: 20,744,189 N446I possibly damaging Het
Evpl T A 11: 116,222,956 K1303* probably null Het
Fam129c A G 8: 71,600,164 D94G probably benign Het
Fam135b A T 15: 71,463,680 V555E probably damaging Het
Fam186b A G 15: 99,280,089 L452P probably benign Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Gcc2 A G 10: 58,256,901 T48A probably benign Het
Gm12169 G A 11: 46,528,555 W66* probably null Het
Gm6619 T G 6: 131,490,391 I73S possibly damaging Het
Gm8267 T A 14: 44,722,940 D116V probably damaging Het
Gtf3c3 G A 1: 54,420,448 T385M probably benign Het
Iqgap2 C A 13: 95,628,076 M1553I probably benign Het
Kcnk1 G T 8: 125,995,568 G37C probably damaging Het
Kifc3 T C 8: 95,137,987 M32V probably benign Het
Krt81 C A 15: 101,461,370 K222N possibly damaging Het
Lrrc63 A G 14: 75,126,257 S145P possibly damaging Het
Mybbp1a T A 11: 72,451,275 V1279E probably benign Het
Olfr1044 T A 2: 86,171,010 D269V probably damaging Het
Olfr742 A T 14: 50,515,396 Y64F probably damaging Het
Pramef8 A G 4: 143,418,840 Y293C probably benign Het
Ptpn18 T C 1: 34,473,335 V407A probably benign Het
Ptpn9 T A 9: 57,027,433 Y160* probably null Het
Ptprj T C 2: 90,449,819 K1045R possibly damaging Het
Rundc3a G T 11: 102,400,046 probably null Het
Scn11a C T 9: 119,758,626 V1351I probably benign Het
Slc26a9 A G 1: 131,762,818 Y520C probably damaging Het
Spata20 G A 11: 94,484,041 A245V probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Swt1 A T 1: 151,411,064 F226I probably benign Het
Taar7f A G 10: 24,049,987 T160A possibly damaging Het
Upf2 A T 2: 6,018,932 I698F unknown Het
Vmn2r84 T C 10: 130,392,113 T85A possibly damaging Het
Zfp810 C A 9: 22,279,272 E78* probably null Het
Zfp937 GTGATAAGGCATTTGCACAAAACAGTCATCTCCTAACACATAAAAGAACACAT G 2: 150,238,710 probably null Het
Other mutations in Zfp426
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01647:Zfp426 APN 9 20478157 start codon destroyed possibly damaging 0.93
IGL02499:Zfp426 APN 9 20473118 splice site probably benign
R0157:Zfp426 UTSW 9 20471136 missense probably benign 0.00
R0356:Zfp426 UTSW 9 20471245 missense probably benign 0.15
R0456:Zfp426 UTSW 9 20470297 missense probably damaging 1.00
R0504:Zfp426 UTSW 9 20470031 missense probably damaging 0.96
R2352:Zfp426 UTSW 9 20470105 missense probably benign 0.08
R2507:Zfp426 UTSW 9 20470431 missense probably benign 0.00
R2509:Zfp426 UTSW 9 20470681 missense possibly damaging 0.68
R3771:Zfp426 UTSW 9 20473117 splice site probably null
R3772:Zfp426 UTSW 9 20473117 splice site probably null
R3773:Zfp426 UTSW 9 20473117 splice site probably null
R3864:Zfp426 UTSW 9 20470086 missense possibly damaging 0.88
R4649:Zfp426 UTSW 9 20470627 missense possibly damaging 0.66
R4798:Zfp426 UTSW 9 20471014 missense probably benign 0.17
R4863:Zfp426 UTSW 9 20470038 missense probably damaging 1.00
R4894:Zfp426 UTSW 9 20475073 intron probably benign
R5421:Zfp426 UTSW 9 20470719 missense probably damaging 0.99
R6084:Zfp426 UTSW 9 20470627 missense possibly damaging 0.66
R6610:Zfp426 UTSW 9 20473093 missense probably damaging 1.00
R7239:Zfp426 UTSW 9 20470591 missense probably benign 0.00
R7646:Zfp426 UTSW 9 20470024 missense probably damaging 0.98
R7827:Zfp426 UTSW 9 20470150 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGGATCAGTCGAGAGGAC -3'
(R):5'- TGAAGAAACCGGCATGACC -3'

Sequencing Primer
(F):5'- CCAGTGTGAGACCTTACATGGATAC -3'
(R):5'- CGGCATGACCCCAGTTAAAGAG -3'
Posted On2019-10-07