Incidental Mutation 'R7441:Zfp810'
ID 576957
Institutional Source Beutler Lab
Gene Symbol Zfp810
Ensembl Gene ENSMUSG00000066829
Gene Name zinc finger protein 810
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock # R7441 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 22276748-22307648 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 22279272 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 78 (E78*)
Ref Sequence ENSEMBL: ENSMUSP00000150816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086278] [ENSMUST00000215202]
AlphaFold Q99K45
Predicted Effect silent
Transcript: ENSMUST00000086278
SMART Domains Protein: ENSMUSP00000083459
Gene: ENSMUSG00000066829

DomainStartEndE-ValueType
KRAB 4 64 1.09e-33 SMART
ZnF_C2H2 126 148 2.44e2 SMART
ZnF_C2H2 182 204 3.07e-1 SMART
ZnF_C2H2 210 232 8.47e-4 SMART
ZnF_C2H2 238 260 6.78e-3 SMART
ZnF_C2H2 266 288 6.13e-1 SMART
ZnF_C2H2 294 316 5.06e-2 SMART
ZnF_C2H2 322 344 4.79e-3 SMART
ZnF_C2H2 350 372 2.99e-4 SMART
ZnF_C2H2 378 400 1.33e-1 SMART
ZnF_C2H2 406 428 2.75e-3 SMART
ZnF_C2H2 434 456 1.58e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000215202
AA Change: E78*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
4921509C19Rik A C 2: 151,472,925 S278A possibly damaging Het
Adamts20 T C 15: 94,353,673 D411G probably damaging Het
Adgrl3 A G 5: 81,724,140 I894V possibly damaging Het
Adprhl1 C T 8: 13,223,069 V1230I probably benign Het
Agpat1 T A 17: 34,610,909 Y77N probably damaging Het
Anpep A G 7: 79,827,644 V725A possibly damaging Het
Apc T A 18: 34,312,073 I674K probably damaging Het
Arhgef2 A G 3: 88,643,955 R808G probably damaging Het
Asap1 A G 15: 64,130,256 V402A probably damaging Het
Aspg T C 12: 112,124,821 V479A possibly damaging Het
B3galnt2 G A 13: 13,994,485 V368M probably benign Het
Bahcc1 T C 11: 120,286,306 S2007P probably damaging Het
Cyfip2 A T 11: 46,196,427 I1212N possibly damaging Het
Dnajc16 A T 4: 141,763,813 D675E probably damaging Het
Dram2 T C 3: 106,555,187 F4L probably damaging Het
Dsp A G 13: 38,195,449 T2057A probably benign Het
Dync1h1 T G 12: 110,636,453 L2176R probably damaging Het
Efhb A T 17: 53,401,521 I707N possibly damaging Het
Eif2ak4 A G 2: 118,471,896 T1555A probably benign Het
Erc1 G A 6: 119,824,951 T35I possibly damaging Het
Esr2 C A 12: 76,141,394 M363I probably benign Het
Etl4 A T 2: 20,744,189 N446I possibly damaging Het
Evpl T A 11: 116,222,956 K1303* probably null Het
Fam129c A G 8: 71,600,164 D94G probably benign Het
Fam135b A T 15: 71,463,680 V555E probably damaging Het
Fam186b A G 15: 99,280,089 L452P probably benign Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Gcc2 A G 10: 58,256,901 T48A probably benign Het
Gm12169 G A 11: 46,528,555 W66* probably null Het
Gm6619 T G 6: 131,490,391 I73S possibly damaging Het
Gm8267 T A 14: 44,722,940 D116V probably damaging Het
Gtf3c3 G A 1: 54,420,448 T385M probably benign Het
Iqgap2 C A 13: 95,628,076 M1553I probably benign Het
Kcnk1 G T 8: 125,995,568 G37C probably damaging Het
Kifc3 T C 8: 95,137,987 M32V probably benign Het
Krt81 C A 15: 101,461,370 K222N possibly damaging Het
Lrrc63 A G 14: 75,126,257 S145P possibly damaging Het
Mybbp1a T A 11: 72,451,275 V1279E probably benign Het
Olfr1044 T A 2: 86,171,010 D269V probably damaging Het
Olfr742 A T 14: 50,515,396 Y64F probably damaging Het
Pramef8 A G 4: 143,418,840 Y293C probably benign Het
Ptpn18 T C 1: 34,473,335 V407A probably benign Het
Ptpn9 T A 9: 57,027,433 Y160* probably null Het
Ptprj T C 2: 90,449,819 K1045R possibly damaging Het
Rundc3a G T 11: 102,400,046 probably null Het
Scn11a C T 9: 119,758,626 V1351I probably benign Het
Slc26a9 A G 1: 131,762,818 Y520C probably damaging Het
Spata20 G A 11: 94,484,041 A245V probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Swt1 A T 1: 151,411,064 F226I probably benign Het
Taar7f A G 10: 24,049,987 T160A possibly damaging Het
Upf2 A T 2: 6,018,932 I698F unknown Het
Vmn2r84 T C 10: 130,392,113 T85A possibly damaging Het
Zfp426 T C 9: 20,470,851 E280G possibly damaging Het
Zfp937 GTGATAAGGCATTTGCACAAAACAGTCATCTCCTAACACATAAAAGAACACAT G 2: 150,238,710 probably null Het
Other mutations in Zfp810
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Zfp810 APN 9 22278309 nonsense probably null
IGL03079:Zfp810 APN 9 22284127 missense probably damaging 1.00
IGL03402:Zfp810 APN 9 22279145 splice site probably null
H8562:Zfp810 UTSW 9 22279091 missense probably benign 0.42
R1116:Zfp810 UTSW 9 22279085 missense probably benign 0.11
R1160:Zfp810 UTSW 9 22278532 missense possibly damaging 0.64
R1171:Zfp810 UTSW 9 22278826 missense possibly damaging 0.95
R1393:Zfp810 UTSW 9 22280514 missense probably benign
R1608:Zfp810 UTSW 9 22278920 missense probably benign 0.00
R1644:Zfp810 UTSW 9 22279028 missense possibly damaging 0.67
R1766:Zfp810 UTSW 9 22278532 missense possibly damaging 0.64
R2568:Zfp810 UTSW 9 22279238 missense probably benign 0.01
R3684:Zfp810 UTSW 9 22278235 missense probably benign 0.01
R4002:Zfp810 UTSW 9 22278892 missense probably damaging 1.00
R4134:Zfp810 UTSW 9 22279073 missense probably damaging 0.97
R4135:Zfp810 UTSW 9 22279073 missense probably damaging 0.97
R4334:Zfp810 UTSW 9 22278784 missense probably benign 0.00
R4545:Zfp810 UTSW 9 22278745 missense probably damaging 0.96
R5399:Zfp810 UTSW 9 22278829 missense possibly damaging 0.91
R5622:Zfp810 UTSW 9 22279096 missense probably benign 0.00
R5643:Zfp810 UTSW 9 22283171 missense probably benign 0.26
R7375:Zfp810 UTSW 9 22290537 critical splice donor site probably null
R7809:Zfp810 UTSW 9 22278982 missense possibly damaging 0.51
R8422:Zfp810 UTSW 9 22283222 nonsense probably null
R8526:Zfp810 UTSW 9 22278290 missense probably damaging 1.00
R8719:Zfp810 UTSW 9 22279275 missense probably benign 0.00
R9177:Zfp810 UTSW 9 22278640 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTCTGATACTGACTGAGGG -3'
(R):5'- GCAGATCAGGAAGCAGAGTTCC -3'

Sequencing Primer
(F):5'- CCTCTGATACTGACTGAGGGTAGAC -3'
(R):5'- TCAGGAAGCAGAGTTCCTAATAC -3'
Posted On 2019-10-07