Incidental Mutation 'R7441:Gcc2'
ID576961
Institutional Source Beutler Lab
Gene Symbol Gcc2
Ensembl Gene ENSMUSG00000038039
Gene NameGRIP and coiled-coil domain containing 2
Synonyms2600014C01Rik, 0610043A03Rik, 2210420P05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R7441 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location58255497-58305599 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58256901 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 48 (T48A)
Ref Sequence ENSEMBL: ENSMUSP00000054033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057659] [ENSMUST00000160427] [ENSMUST00000162041] [ENSMUST00000162860] [ENSMUST00000162984]
Predicted Effect probably benign
Transcript: ENSMUST00000057659
AA Change: T48A

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000054033
Gene: ENSMUSG00000038039
AA Change: T48A

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
coiled coil region 33 282 N/A INTRINSIC
internal_repeat_2 353 378 3.94e-5 PROSPERO
internal_repeat_2 382 406 3.94e-5 PROSPERO
coiled coil region 790 882 N/A INTRINSIC
low complexity region 939 964 N/A INTRINSIC
internal_repeat_1 1093 1111 1.93e-5 PROSPERO
low complexity region 1115 1132 N/A INTRINSIC
low complexity region 1179 1190 N/A INTRINSIC
coiled coil region 1441 1470 N/A INTRINSIC
internal_repeat_1 1554 1572 1.93e-5 PROSPERO
Grip 1608 1655 4.37e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160427
AA Change: T12A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000124411
Gene: ENSMUSG00000038039
AA Change: T12A

DomainStartEndE-ValueType
coiled coil region 32 94 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162041
AA Change: T12A

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000124787
Gene: ENSMUSG00000038039
AA Change: T12A

DomainStartEndE-ValueType
coiled coil region 32 246 N/A INTRINSIC
internal_repeat_2 317 342 3.28e-5 PROSPERO
internal_repeat_2 346 370 3.28e-5 PROSPERO
coiled coil region 754 846 N/A INTRINSIC
low complexity region 903 928 N/A INTRINSIC
internal_repeat_1 1057 1075 1.6e-5 PROSPERO
low complexity region 1079 1096 N/A INTRINSIC
low complexity region 1143 1154 N/A INTRINSIC
coiled coil region 1405 1434 N/A INTRINSIC
internal_repeat_1 1518 1536 1.6e-5 PROSPERO
Grip 1572 1619 4.37e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162860
SMART Domains Protein: ENSMUSP00000124152
Gene: ENSMUSG00000038039

DomainStartEndE-ValueType
coiled coil region 46 182 N/A INTRINSIC
internal_repeat_2 253 278 4.17e-5 PROSPERO
internal_repeat_2 282 306 4.17e-5 PROSPERO
coiled coil region 690 782 N/A INTRINSIC
low complexity region 839 864 N/A INTRINSIC
internal_repeat_1 993 1011 2.06e-5 PROSPERO
low complexity region 1015 1032 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
coiled coil region 1341 1370 N/A INTRINSIC
internal_repeat_1 1450 1468 2.06e-5 PROSPERO
Grip 1504 1551 4.37e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162984
SMART Domains Protein: ENSMUSP00000124988
Gene: ENSMUSG00000038039

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peripheral membrane protein localized to the trans-Golgi network. It is sensitive to brefeldin A. This encoded protein contains a GRIP domain which is thought to be used in targeting. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
4921509C19Rik A C 2: 151,472,925 S278A possibly damaging Het
Adamts20 T C 15: 94,353,673 D411G probably damaging Het
Adgrl3 A G 5: 81,724,140 I894V possibly damaging Het
Adprhl1 C T 8: 13,223,069 V1230I probably benign Het
Agpat1 T A 17: 34,610,909 Y77N probably damaging Het
Anpep A G 7: 79,827,644 V725A possibly damaging Het
Apc T A 18: 34,312,073 I674K probably damaging Het
Arhgef2 A G 3: 88,643,955 R808G probably damaging Het
Asap1 A G 15: 64,130,256 V402A probably damaging Het
Aspg T C 12: 112,124,821 V479A possibly damaging Het
B3galnt2 G A 13: 13,994,485 V368M probably benign Het
Bahcc1 T C 11: 120,286,306 S2007P probably damaging Het
Cyfip2 A T 11: 46,196,427 I1212N possibly damaging Het
Dnajc16 A T 4: 141,763,813 D675E probably damaging Het
Dram2 T C 3: 106,555,187 F4L probably damaging Het
Dsp A G 13: 38,195,449 T2057A probably benign Het
Dync1h1 T G 12: 110,636,453 L2176R probably damaging Het
Efhb A T 17: 53,401,521 I707N possibly damaging Het
Eif2ak4 A G 2: 118,471,896 T1555A probably benign Het
Erc1 G A 6: 119,824,951 T35I possibly damaging Het
Esr2 C A 12: 76,141,394 M363I probably benign Het
Etl4 A T 2: 20,744,189 N446I possibly damaging Het
Evpl T A 11: 116,222,956 K1303* probably null Het
Fam129c A G 8: 71,600,164 D94G probably benign Het
Fam135b A T 15: 71,463,680 V555E probably damaging Het
Fam186b A G 15: 99,280,089 L452P probably benign Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Gm12169 G A 11: 46,528,555 W66* probably null Het
Gm6619 T G 6: 131,490,391 I73S possibly damaging Het
Gm8267 T A 14: 44,722,940 D116V probably damaging Het
Gtf3c3 G A 1: 54,420,448 T385M probably benign Het
Iqgap2 C A 13: 95,628,076 M1553I probably benign Het
Kcnk1 G T 8: 125,995,568 G37C probably damaging Het
Kifc3 T C 8: 95,137,987 M32V probably benign Het
Krt81 C A 15: 101,461,370 K222N possibly damaging Het
Lrrc63 A G 14: 75,126,257 S145P possibly damaging Het
Mybbp1a T A 11: 72,451,275 V1279E probably benign Het
Olfr1044 T A 2: 86,171,010 D269V probably damaging Het
Olfr742 A T 14: 50,515,396 Y64F probably damaging Het
Pramef8 A G 4: 143,418,840 Y293C probably benign Het
Ptpn18 T C 1: 34,473,335 V407A probably benign Het
Ptpn9 T A 9: 57,027,433 Y160* probably null Het
Ptprj T C 2: 90,449,819 K1045R possibly damaging Het
Rundc3a G T 11: 102,400,046 probably null Het
Scn11a C T 9: 119,758,626 V1351I probably benign Het
Slc26a9 A G 1: 131,762,818 Y520C probably damaging Het
Spata20 G A 11: 94,484,041 A245V probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Swt1 A T 1: 151,411,064 F226I probably benign Het
Taar7f A G 10: 24,049,987 T160A possibly damaging Het
Upf2 A T 2: 6,018,932 I698F unknown Het
Vmn2r84 T C 10: 130,392,113 T85A possibly damaging Het
Zfp426 T C 9: 20,470,851 E280G possibly damaging Het
Zfp810 C A 9: 22,279,272 E78* probably null Het
Zfp937 GTGATAAGGCATTTGCACAAAACAGTCATCTCCTAACACATAAAAGAACACAT G 2: 150,238,710 probably null Het
Other mutations in Gcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Gcc2 APN 10 58292680 missense probably damaging 1.00
IGL00850:Gcc2 APN 10 58258248 missense probably benign 0.00
IGL00935:Gcc2 APN 10 58278779 splice site probably benign
IGL01551:Gcc2 APN 10 58298869 splice site probably benign
IGL01642:Gcc2 APN 10 58280612 missense probably benign 0.00
IGL02041:Gcc2 APN 10 58269281 missense probably damaging 1.00
IGL02215:Gcc2 APN 10 58271636 missense probably benign 0.36
IGL02448:Gcc2 APN 10 58292571 nonsense probably null
IGL02698:Gcc2 APN 10 58271290 missense possibly damaging 0.76
IGL02888:Gcc2 APN 10 58294828 missense probably damaging 1.00
IGL02936:Gcc2 APN 10 58296140 missense probably damaging 1.00
IGL03223:Gcc2 APN 10 58298734 missense probably damaging 1.00
IGL03249:Gcc2 APN 10 58270992 nonsense probably null
R0179:Gcc2 UTSW 10 58276650 missense probably benign 0.39
R0528:Gcc2 UTSW 10 58298689 missense probably damaging 1.00
R1569:Gcc2 UTSW 10 58270171 missense probably benign 0.00
R1606:Gcc2 UTSW 10 58269448 missense probably damaging 1.00
R1725:Gcc2 UTSW 10 58304115 missense possibly damaging 0.95
R1916:Gcc2 UTSW 10 58276663 missense probably damaging 1.00
R1956:Gcc2 UTSW 10 58286143 missense possibly damaging 0.66
R2058:Gcc2 UTSW 10 58285957 missense probably benign 0.10
R2114:Gcc2 UTSW 10 58269540 nonsense probably null
R2280:Gcc2 UTSW 10 58269680 missense probably benign 0.38
R2435:Gcc2 UTSW 10 58294780 missense probably damaging 1.00
R2876:Gcc2 UTSW 10 58290302 missense probably damaging 0.99
R4753:Gcc2 UTSW 10 58290382 missense probably benign 0.20
R4827:Gcc2 UTSW 10 58286131 critical splice acceptor site probably null
R4911:Gcc2 UTSW 10 58270439 missense probably damaging 1.00
R5033:Gcc2 UTSW 10 58278806 missense probably damaging 0.98
R5224:Gcc2 UTSW 10 58286160 missense probably damaging 1.00
R5271:Gcc2 UTSW 10 58269695 missense possibly damaging 0.46
R5398:Gcc2 UTSW 10 58269507 missense probably benign 0.00
R5411:Gcc2 UTSW 10 58270969 missense probably damaging 0.99
R5594:Gcc2 UTSW 10 58287242 missense probably damaging 0.99
R5825:Gcc2 UTSW 10 58294821 missense probably damaging 1.00
R5974:Gcc2 UTSW 10 58258243 missense probably damaging 0.99
R5987:Gcc2 UTSW 10 58255847 utr 5 prime probably benign
R6195:Gcc2 UTSW 10 58270984 missense probably damaging 0.96
R6198:Gcc2 UTSW 10 58292590 missense probably benign 0.26
R6233:Gcc2 UTSW 10 58270984 missense probably damaging 0.96
R6331:Gcc2 UTSW 10 58271465 missense probably benign
R6349:Gcc2 UTSW 10 58269474 missense probably benign 0.01
R6593:Gcc2 UTSW 10 58271507 missense probably damaging 1.00
R6632:Gcc2 UTSW 10 58270049 unclassified probably null
R6647:Gcc2 UTSW 10 58287281 critical splice donor site probably null
R6774:Gcc2 UTSW 10 58281439 missense possibly damaging 0.94
R6808:Gcc2 UTSW 10 58258242 missense probably damaging 0.99
R7072:Gcc2 UTSW 10 58270927 missense probably benign 0.02
R7220:Gcc2 UTSW 10 58280594 missense probably benign 0.00
R7352:Gcc2 UTSW 10 58280698 critical splice donor site probably null
R7384:Gcc2 UTSW 10 58269964 missense probably damaging 1.00
R7439:Gcc2 UTSW 10 58256901 missense probably benign 0.08
R7543:Gcc2 UTSW 10 58271264 missense probably benign 0.02
X0018:Gcc2 UTSW 10 58278814 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGTTTTCGGCAGACACTG -3'
(R):5'- GGAGGATTACACCTTGTGCC -3'

Sequencing Primer
(F):5'- TCGGCAGACACTGTGTTTC -3'
(R):5'- TGGTGGCTCACAACTGTAAC -3'
Posted On2019-10-07