Incidental Mutation 'R7441:Cyfip2'
ID576963
Institutional Source Beutler Lab
Gene Symbol Cyfip2
Ensembl Gene ENSMUSG00000020340
Gene Namecytoplasmic FMR1 interacting protein 2
Synonyms1500004I01Rik, Pir121, 6430511D02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7441 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location46193850-46312859 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46196427 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1212 (I1212N)
Ref Sequence ENSEMBL: ENSMUSP00000090853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093165] [ENSMUST00000093166] [ENSMUST00000165599]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093165
AA Change: I1212N

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000090853
Gene: ENSMUSG00000020340
AA Change: I1212N

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:DUF1394 59 303 5.4e-12 PFAM
Pfam:FragX_IP 388 1221 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000093166
AA Change: I1212N

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000090854
Gene: ENSMUSG00000020340
AA Change: I1212N

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:FragX_IP 384 1223 N/A PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000119801
Gene: ENSMUSG00000020340
AA Change: I906N

DomainStartEndE-ValueType
Pfam:FragX_IP 58 230 4e-66 PFAM
Pfam:FragX_IP 246 916 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165599
AA Change: I1212N

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127586
Gene: ENSMUSG00000020340
AA Change: I1212N

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:FragX_IP 384 1223 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for knock-out allele exhibit complete neonatal lethality. Mice homozygous for a dominant spontaneous mutation exhibit impaired behavioral response to cocaine, fewer dendritic spines and reduced miniature excitatory postsynaptic current frequency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
4921509C19Rik A C 2: 151,472,925 S278A possibly damaging Het
Adamts20 T C 15: 94,353,673 D411G probably damaging Het
Adgrl3 A G 5: 81,724,140 I894V possibly damaging Het
Adprhl1 C T 8: 13,223,069 V1230I probably benign Het
Agpat1 T A 17: 34,610,909 Y77N probably damaging Het
Anpep A G 7: 79,827,644 V725A possibly damaging Het
Apc T A 18: 34,312,073 I674K probably damaging Het
Arhgef2 A G 3: 88,643,955 R808G probably damaging Het
Asap1 A G 15: 64,130,256 V402A probably damaging Het
Aspg T C 12: 112,124,821 V479A possibly damaging Het
B3galnt2 G A 13: 13,994,485 V368M probably benign Het
Bahcc1 T C 11: 120,286,306 S2007P probably damaging Het
Dnajc16 A T 4: 141,763,813 D675E probably damaging Het
Dram2 T C 3: 106,555,187 F4L probably damaging Het
Dsp A G 13: 38,195,449 T2057A probably benign Het
Dync1h1 T G 12: 110,636,453 L2176R probably damaging Het
Efhb A T 17: 53,401,521 I707N possibly damaging Het
Eif2ak4 A G 2: 118,471,896 T1555A probably benign Het
Erc1 G A 6: 119,824,951 T35I possibly damaging Het
Esr2 C A 12: 76,141,394 M363I probably benign Het
Etl4 A T 2: 20,744,189 N446I possibly damaging Het
Evpl T A 11: 116,222,956 K1303* probably null Het
Fam129c A G 8: 71,600,164 D94G probably benign Het
Fam135b A T 15: 71,463,680 V555E probably damaging Het
Fam186b A G 15: 99,280,089 L452P probably benign Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Gcc2 A G 10: 58,256,901 T48A probably benign Het
Gm12169 G A 11: 46,528,555 W66* probably null Het
Gm6619 T G 6: 131,490,391 I73S possibly damaging Het
Gm8267 T A 14: 44,722,940 D116V probably damaging Het
Gtf3c3 G A 1: 54,420,448 T385M probably benign Het
Iqgap2 C A 13: 95,628,076 M1553I probably benign Het
Kcnk1 G T 8: 125,995,568 G37C probably damaging Het
Kifc3 T C 8: 95,137,987 M32V probably benign Het
Krt81 C A 15: 101,461,370 K222N possibly damaging Het
Lrrc63 A G 14: 75,126,257 S145P possibly damaging Het
Mybbp1a T A 11: 72,451,275 V1279E probably benign Het
Olfr1044 T A 2: 86,171,010 D269V probably damaging Het
Olfr742 A T 14: 50,515,396 Y64F probably damaging Het
Pramef8 A G 4: 143,418,840 Y293C probably benign Het
Ptpn18 T C 1: 34,473,335 V407A probably benign Het
Ptpn9 T A 9: 57,027,433 Y160* probably null Het
Ptprj T C 2: 90,449,819 K1045R possibly damaging Het
Rundc3a G T 11: 102,400,046 probably null Het
Scn11a C T 9: 119,758,626 V1351I probably benign Het
Slc26a9 A G 1: 131,762,818 Y520C probably damaging Het
Spata20 G A 11: 94,484,041 A245V probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Swt1 A T 1: 151,411,064 F226I probably benign Het
Taar7f A G 10: 24,049,987 T160A possibly damaging Het
Upf2 A T 2: 6,018,932 I698F unknown Het
Vmn2r84 T C 10: 130,392,113 T85A possibly damaging Het
Zfp426 T C 9: 20,470,851 E280G possibly damaging Het
Zfp810 C A 9: 22,279,272 E78* probably null Het
Zfp937 GTGATAAGGCATTTGCACAAAACAGTCATCTCCTAACACATAAAAGAACACAT G 2: 150,238,710 probably null Het
Other mutations in Cyfip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Cyfip2 APN 11 46200685 missense possibly damaging 0.74
IGL01352:Cyfip2 APN 11 46265996 missense probably benign 0.01
IGL01685:Cyfip2 APN 11 46207488 splice site probably benign
IGL02367:Cyfip2 APN 11 46276905 nonsense probably null
IGL02390:Cyfip2 APN 11 46221398 missense possibly damaging 0.58
IGL02471:Cyfip2 APN 11 46200803 missense possibly damaging 0.58
IGL02583:Cyfip2 APN 11 46249758 missense possibly damaging 0.56
IGL03199:Cyfip2 APN 11 46276843 missense probably benign 0.07
IGL02835:Cyfip2 UTSW 11 46249771 missense probably benign 0.00
R0081:Cyfip2 UTSW 11 46253998 nonsense probably null
R0288:Cyfip2 UTSW 11 46253972 missense possibly damaging 0.94
R1830:Cyfip2 UTSW 11 46199019 missense probably damaging 1.00
R1869:Cyfip2 UTSW 11 46224168 missense probably benign 0.40
R1989:Cyfip2 UTSW 11 46253998 nonsense probably null
R2045:Cyfip2 UTSW 11 46249789 missense probably benign 0.00
R2101:Cyfip2 UTSW 11 46242443 missense probably damaging 1.00
R2131:Cyfip2 UTSW 11 46286131 missense possibly damaging 0.78
R2162:Cyfip2 UTSW 11 46261506 missense probably benign 0.03
R2299:Cyfip2 UTSW 11 46286131 missense probably benign 0.02
R3831:Cyfip2 UTSW 11 46261506 missense probably benign 0.03
R3832:Cyfip2 UTSW 11 46261506 missense probably benign 0.03
R3833:Cyfip2 UTSW 11 46261506 missense probably benign 0.03
R3881:Cyfip2 UTSW 11 46208335 missense probably damaging 1.00
R4127:Cyfip2 UTSW 11 46270647 missense probably benign 0.00
R4385:Cyfip2 UTSW 11 46242403 missense probably benign 0.05
R4617:Cyfip2 UTSW 11 46254018 missense probably damaging 1.00
R4739:Cyfip2 UTSW 11 46279993 missense probably damaging 0.99
R5232:Cyfip2 UTSW 11 46242378 missense probably damaging 1.00
R5365:Cyfip2 UTSW 11 46247630 missense probably damaging 0.99
R5383:Cyfip2 UTSW 11 46278091 missense possibly damaging 0.83
R5447:Cyfip2 UTSW 11 46291586 missense possibly damaging 0.72
R5450:Cyfip2 UTSW 11 46284252 missense probably benign 0.00
R5796:Cyfip2 UTSW 11 46198996 missense probably benign 0.01
R5820:Cyfip2 UTSW 11 46200704 missense probably damaging 1.00
R5925:Cyfip2 UTSW 11 46207436 missense probably damaging 1.00
R6143:Cyfip2 UTSW 11 46253965 nonsense probably null
R6321:Cyfip2 UTSW 11 46291520 missense probably benign 0.01
R6502:Cyfip2 UTSW 11 46221346 missense probably damaging 1.00
R6511:Cyfip2 UTSW 11 46196308 missense probably benign 0.00
R6521:Cyfip2 UTSW 11 46254588 missense probably damaging 1.00
R6660:Cyfip2 UTSW 11 46249807 missense possibly damaging 0.89
R6836:Cyfip2 UTSW 11 46272640 missense probably benign 0.16
R6866:Cyfip2 UTSW 11 46242459 nonsense probably null
R7062:Cyfip2 UTSW 11 46260832 missense probably damaging 1.00
R7192:Cyfip2 UTSW 11 46254666 missense probably benign 0.21
R7231:Cyfip2 UTSW 11 46224136 missense probably benign
R7258:Cyfip2 UTSW 11 46224177 missense probably benign 0.02
R7365:Cyfip2 UTSW 11 46207440 nonsense probably null
R7561:Cyfip2 UTSW 11 46270598 missense probably benign 0.00
R7831:Cyfip2 UTSW 11 46196446 missense probably damaging 1.00
R7871:Cyfip2 UTSW 11 46242350 missense probably damaging 1.00
R7914:Cyfip2 UTSW 11 46196446 missense probably damaging 1.00
R7954:Cyfip2 UTSW 11 46242350 missense probably damaging 1.00
Z1176:Cyfip2 UTSW 11 46222615 missense not run
Z1177:Cyfip2 UTSW 11 46222615 missense not run
Predicted Primers PCR Primer
(F):5'- ACTGTCAACTGGACCTGCTG -3'
(R):5'- CAGCAACCTTTAGCGTTTTATTTGG -3'

Sequencing Primer
(F):5'- CAGGCTGGTCACTGTGTTCTC -3'
(R):5'- TGGGAACTGTAGAGAAGATCTTTAAC -3'
Posted On2019-10-07