Incidental Mutation 'R7441:Bahcc1'
ID576969
Institutional Source Beutler Lab
Gene Symbol Bahcc1
Ensembl Gene ENSMUSG00000039741
Gene NameBAH domain and coiled-coil containing 1
SynonymsKIAA1447
MMRRC Submission
Accession Numbers

Genbank: NM_198423; MGI: 2679272

Is this an essential gene? Probably essential (E-score: 0.789) question?
Stock #R7441 (G1)
Quality Score213.009
Status Not validated
Chromosome11
Chromosomal Location120232947-120292296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120286306 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 2007 (S2007P)
Ref Sequence ENSEMBL: ENSMUSP00000112827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044985] [ENSMUST00000118987] [ENSMUST00000122148]
Predicted Effect probably damaging
Transcript: ENSMUST00000044985
AA Change: S2007P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000043643
Gene: ENSMUSG00000039741
AA Change: S2007P

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
low complexity region 219 233 N/A INTRINSIC
low complexity region 351 366 N/A INTRINSIC
low complexity region 756 778 N/A INTRINSIC
low complexity region 811 821 N/A INTRINSIC
low complexity region 882 890 N/A INTRINSIC
coiled coil region 931 976 N/A INTRINSIC
low complexity region 1042 1059 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1172 1183 N/A INTRINSIC
low complexity region 1267 1277 N/A INTRINSIC
coiled coil region 1346 1373 N/A INTRINSIC
coiled coil region 1437 1486 N/A INTRINSIC
low complexity region 1706 1711 N/A INTRINSIC
low complexity region 1729 1740 N/A INTRINSIC
low complexity region 1746 1764 N/A INTRINSIC
low complexity region 1865 1891 N/A INTRINSIC
low complexity region 2088 2104 N/A INTRINSIC
low complexity region 2135 2158 N/A INTRINSIC
low complexity region 2209 2224 N/A INTRINSIC
low complexity region 2225 2245 N/A INTRINSIC
low complexity region 2317 2332 N/A INTRINSIC
low complexity region 2348 2387 N/A INTRINSIC
low complexity region 2401 2410 N/A INTRINSIC
low complexity region 2429 2447 N/A INTRINSIC
BAH 2517 2637 4.19e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118987
AA Change: S2007P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112784
Gene: ENSMUSG00000039741
AA Change: S2007P

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
low complexity region 219 233 N/A INTRINSIC
low complexity region 351 366 N/A INTRINSIC
low complexity region 756 778 N/A INTRINSIC
low complexity region 811 821 N/A INTRINSIC
low complexity region 882 890 N/A INTRINSIC
coiled coil region 931 976 N/A INTRINSIC
low complexity region 1042 1059 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1172 1183 N/A INTRINSIC
low complexity region 1267 1277 N/A INTRINSIC
coiled coil region 1346 1373 N/A INTRINSIC
coiled coil region 1437 1486 N/A INTRINSIC
low complexity region 1706 1711 N/A INTRINSIC
low complexity region 1729 1740 N/A INTRINSIC
low complexity region 1746 1764 N/A INTRINSIC
low complexity region 1865 1891 N/A INTRINSIC
low complexity region 2088 2104 N/A INTRINSIC
low complexity region 2135 2158 N/A INTRINSIC
low complexity region 2209 2224 N/A INTRINSIC
low complexity region 2225 2245 N/A INTRINSIC
low complexity region 2317 2332 N/A INTRINSIC
low complexity region 2348 2387 N/A INTRINSIC
low complexity region 2401 2410 N/A INTRINSIC
low complexity region 2429 2447 N/A INTRINSIC
BAH 2517 2637 4.19e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122148
AA Change: S2007P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112827
Gene: ENSMUSG00000039741
AA Change: S2007P

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
low complexity region 219 233 N/A INTRINSIC
low complexity region 351 366 N/A INTRINSIC
low complexity region 756 778 N/A INTRINSIC
low complexity region 811 821 N/A INTRINSIC
low complexity region 882 890 N/A INTRINSIC
coiled coil region 931 976 N/A INTRINSIC
low complexity region 1042 1059 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1172 1183 N/A INTRINSIC
low complexity region 1267 1277 N/A INTRINSIC
coiled coil region 1346 1373 N/A INTRINSIC
coiled coil region 1437 1486 N/A INTRINSIC
low complexity region 1706 1711 N/A INTRINSIC
low complexity region 1729 1740 N/A INTRINSIC
low complexity region 1746 1764 N/A INTRINSIC
low complexity region 1865 1891 N/A INTRINSIC
low complexity region 2088 2104 N/A INTRINSIC
low complexity region 2135 2158 N/A INTRINSIC
low complexity region 2209 2224 N/A INTRINSIC
low complexity region 2225 2245 N/A INTRINSIC
low complexity region 2317 2332 N/A INTRINSIC
low complexity region 2348 2387 N/A INTRINSIC
low complexity region 2401 2410 N/A INTRINSIC
low complexity region 2429 2447 N/A INTRINSIC
BAH 2517 2637 4.19e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality for the majority of mutants. Those that survive exhibit hind leg motor dysfunction. [provided by MGI curators]
Allele List at MGI

All alleles(26) : Targeted, knock-out(2) Gene trapped(24)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
4921509C19Rik A C 2: 151,472,925 S278A possibly damaging Het
Adamts20 T C 15: 94,353,673 D411G probably damaging Het
Adgrl3 A G 5: 81,724,140 I894V possibly damaging Het
Adprhl1 C T 8: 13,223,069 V1230I probably benign Het
Agpat1 T A 17: 34,610,909 Y77N probably damaging Het
Anpep A G 7: 79,827,644 V725A possibly damaging Het
Apc T A 18: 34,312,073 I674K probably damaging Het
Arhgef2 A G 3: 88,643,955 R808G probably damaging Het
Asap1 A G 15: 64,130,256 V402A probably damaging Het
Aspg T C 12: 112,124,821 V479A possibly damaging Het
B3galnt2 G A 13: 13,994,485 V368M probably benign Het
Cyfip2 A T 11: 46,196,427 I1212N possibly damaging Het
Dnajc16 A T 4: 141,763,813 D675E probably damaging Het
Dram2 T C 3: 106,555,187 F4L probably damaging Het
Dsp A G 13: 38,195,449 T2057A probably benign Het
Dync1h1 T G 12: 110,636,453 L2176R probably damaging Het
Efhb A T 17: 53,401,521 I707N possibly damaging Het
Eif2ak4 A G 2: 118,471,896 T1555A probably benign Het
Erc1 G A 6: 119,824,951 T35I possibly damaging Het
Esr2 C A 12: 76,141,394 M363I probably benign Het
Etl4 A T 2: 20,744,189 N446I possibly damaging Het
Evpl T A 11: 116,222,956 K1303* probably null Het
Fam129c A G 8: 71,600,164 D94G probably benign Het
Fam135b A T 15: 71,463,680 V555E probably damaging Het
Fam186b A G 15: 99,280,089 L452P probably benign Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Gcc2 A G 10: 58,256,901 T48A probably benign Het
Gm12169 G A 11: 46,528,555 W66* probably null Het
Gm6619 T G 6: 131,490,391 I73S possibly damaging Het
Gm8267 T A 14: 44,722,940 D116V probably damaging Het
Gtf3c3 G A 1: 54,420,448 T385M probably benign Het
Iqgap2 C A 13: 95,628,076 M1553I probably benign Het
Kcnk1 G T 8: 125,995,568 G37C probably damaging Het
Kifc3 T C 8: 95,137,987 M32V probably benign Het
Krt81 C A 15: 101,461,370 K222N possibly damaging Het
Lrrc63 A G 14: 75,126,257 S145P possibly damaging Het
Mybbp1a T A 11: 72,451,275 V1279E probably benign Het
Olfr1044 T A 2: 86,171,010 D269V probably damaging Het
Olfr742 A T 14: 50,515,396 Y64F probably damaging Het
Pramef8 A G 4: 143,418,840 Y293C probably benign Het
Ptpn18 T C 1: 34,473,335 V407A probably benign Het
Ptpn9 T A 9: 57,027,433 Y160* probably null Het
Ptprj T C 2: 90,449,819 K1045R possibly damaging Het
Rundc3a G T 11: 102,400,046 probably null Het
Scn11a C T 9: 119,758,626 V1351I probably benign Het
Slc26a9 A G 1: 131,762,818 Y520C probably damaging Het
Spata20 G A 11: 94,484,041 A245V probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Swt1 A T 1: 151,411,064 F226I probably benign Het
Taar7f A G 10: 24,049,987 T160A possibly damaging Het
Upf2 A T 2: 6,018,932 I698F unknown Het
Vmn2r84 T C 10: 130,392,113 T85A possibly damaging Het
Zfp426 T C 9: 20,470,851 E280G possibly damaging Het
Zfp810 C A 9: 22,279,272 E78* probably null Het
Zfp937 GTGATAAGGCATTTGCACAAAACAGTCATCTCCTAACACATAAAAGAACACAT G 2: 150,238,710 probably null Het
Other mutations in Bahcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Bahcc1 APN 11 120272304 missense probably damaging 1.00
IGL00536:Bahcc1 APN 11 120285045 missense probably damaging 0.96
IGL01339:Bahcc1 APN 11 120289512 missense probably damaging 1.00
IGL01695:Bahcc1 APN 11 120276609 missense probably benign 0.02
IGL01744:Bahcc1 APN 11 120271737 missense probably benign 0.02
IGL01769:Bahcc1 APN 11 120280204 splice site probably benign
IGL01982:Bahcc1 APN 11 120287473 missense probably damaging 1.00
IGL02341:Bahcc1 APN 11 120272520 missense probably damaging 1.00
IGL02535:Bahcc1 APN 11 120287536 missense possibly damaging 0.88
IGL02559:Bahcc1 APN 11 120285172 missense probably damaging 0.97
IGL02579:Bahcc1 APN 11 120285349 splice site probably benign
IGL02609:Bahcc1 APN 11 120289398 missense possibly damaging 0.93
IGL02678:Bahcc1 APN 11 120272871 missense probably damaging 1.00
IGL02800:Bahcc1 APN 11 120272934 missense probably damaging 1.00
IGL02963:Bahcc1 APN 11 120274932 missense possibly damaging 0.86
IGL03128:Bahcc1 APN 11 120268434 splice site probably benign
IGL03242:Bahcc1 APN 11 120268300 splice site probably benign
IGL03248:Bahcc1 APN 11 120268409 missense probably damaging 1.00
Dimensionality UTSW 11 120273009 missense probably damaging 1.00
R0019:Bahcc1 UTSW 11 120289771 missense probably damaging 1.00
R0040:Bahcc1 UTSW 11 120268370 missense probably damaging 1.00
R0040:Bahcc1 UTSW 11 120268370 missense probably damaging 1.00
R0148:Bahcc1 UTSW 11 120268404 missense probably damaging 1.00
R0164:Bahcc1 UTSW 11 120285074 splice site probably benign
R0321:Bahcc1 UTSW 11 120273425 critical splice donor site probably null
R0671:Bahcc1 UTSW 11 120287320 missense probably damaging 1.00
R0737:Bahcc1 UTSW 11 120272841 missense probably damaging 1.00
R1452:Bahcc1 UTSW 11 120282239 splice site probably benign
R1570:Bahcc1 UTSW 11 120272183 missense possibly damaging 0.74
R1914:Bahcc1 UTSW 11 120285399 missense probably damaging 1.00
R2010:Bahcc1 UTSW 11 120272778 missense probably damaging 1.00
R2075:Bahcc1 UTSW 11 120271689 missense probably damaging 1.00
R2085:Bahcc1 UTSW 11 120288082 missense probably damaging 1.00
R3552:Bahcc1 UTSW 11 120276772 missense possibly damaging 0.90
R3711:Bahcc1 UTSW 11 120275097 missense probably benign 0.27
R3804:Bahcc1 UTSW 11 120283358 missense probably benign 0.01
R4349:Bahcc1 UTSW 11 120259201 missense probably damaging 1.00
R4557:Bahcc1 UTSW 11 120275088 missense probably damaging 1.00
R4801:Bahcc1 UTSW 11 120282225 missense probably benign 0.00
R4802:Bahcc1 UTSW 11 120282225 missense probably benign 0.00
R4908:Bahcc1 UTSW 11 120287754 missense probably benign 0.36
R4941:Bahcc1 UTSW 11 120286665 missense probably benign
R5217:Bahcc1 UTSW 11 120274459 nonsense probably null
R5241:Bahcc1 UTSW 11 120271403 missense probably damaging 1.00
R5432:Bahcc1 UTSW 11 120287988 missense probably benign 0.02
R5696:Bahcc1 UTSW 11 120273987 missense probably damaging 1.00
R5724:Bahcc1 UTSW 11 120285366 missense possibly damaging 0.78
R5725:Bahcc1 UTSW 11 120274888 missense probably benign
R5788:Bahcc1 UTSW 11 120286352 missense probably damaging 1.00
R5893:Bahcc1 UTSW 11 120285430 missense probably damaging 0.99
R5900:Bahcc1 UTSW 11 120284493 missense probably damaging 1.00
R6014:Bahcc1 UTSW 11 120289789 missense probably benign 0.00
R6058:Bahcc1 UTSW 11 120287385 missense probably damaging 1.00
R6107:Bahcc1 UTSW 11 120272888 missense probably benign 0.00
R6302:Bahcc1 UTSW 11 120276808 missense probably damaging 1.00
R6525:Bahcc1 UTSW 11 120285222 missense probably damaging 1.00
R6550:Bahcc1 UTSW 11 120276651 missense possibly damaging 0.94
R6822:Bahcc1 UTSW 11 120287721 missense probably damaging 1.00
R6836:Bahcc1 UTSW 11 120271757 nonsense probably null
R6846:Bahcc1 UTSW 11 120271596 missense possibly damaging 0.92
R6916:Bahcc1 UTSW 11 120273009 missense probably damaging 1.00
R6966:Bahcc1 UTSW 11 120283159 missense probably damaging 0.99
R7097:Bahcc1 UTSW 11 120272646 missense possibly damaging 0.87
R7289:Bahcc1 UTSW 11 120280174 missense probably benign 0.08
R7520:Bahcc1 UTSW 11 120276205 missense possibly damaging 0.47
R7556:Bahcc1 UTSW 11 120287763 missense probably damaging 1.00
R7672:Bahcc1 UTSW 11 120283346 missense possibly damaging 0.63
R7791:Bahcc1 UTSW 11 120268377 missense probably damaging 1.00
R7794:Bahcc1 UTSW 11 120272681 nonsense probably null
R7802:Bahcc1 UTSW 11 120274692 missense probably benign 0.03
X0026:Bahcc1 UTSW 11 120271752 missense probably benign 0.20
Z1176:Bahcc1 UTSW 11 120276609 missense possibly damaging 0.89
Z1176:Bahcc1 UTSW 11 120284394 missense probably benign 0.00
Z1177:Bahcc1 UTSW 11 120272921 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GAAGCTAGGGCATGTGTCTG -3'
(R):5'- AGTTTTGGTGAGGCCCAAGTAG -3'

Sequencing Primer
(F):5'- CTGCTTGTATGTGGGGCCAG -3'
(R):5'- CCAAGTAGGAGGGGGCTTC -3'
Posted On2019-10-07