Incidental Mutation 'R7441:Esr2'
ID576970
Institutional Source Beutler Lab
Gene Symbol Esr2
Ensembl Gene ENSMUSG00000021055
Gene Nameestrogen receptor 2 (beta)
SynonymsERbeta, ER beta, Estrb, oestrogen receptor beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.643) question?
Stock #R7441 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location76120419-76177259 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 76141394 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 363 (M363I)
Ref Sequence ENSEMBL: ENSMUSP00000151463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076634] [ENSMUST00000101291] [ENSMUST00000110421] [ENSMUST00000133564] [ENSMUST00000218621]
Predicted Effect probably benign
Transcript: ENSMUST00000076634
AA Change: M363I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075932
Gene: ENSMUSG00000021055
AA Change: M363I

DomainStartEndE-ValueType
Pfam:ERbeta_N 31 143 4.2e-41 PFAM
ZnF_C4 165 236 1.84e-34 SMART
HOLI 319 488 5.99e-34 SMART
Blast:HOLI 489 519 7e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000101291
AA Change: M344I

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000098849
Gene: ENSMUSG00000021055
AA Change: M344I

DomainStartEndE-ValueType
Pfam:ERbeta_N 31 141 1.9e-56 PFAM
ZnF_C4 165 236 1.84e-34 SMART
HOLI 319 506 6.88e-34 SMART
Blast:HOLI 507 537 8e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000110421
AA Change: M344I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106051
Gene: ENSMUSG00000021055
AA Change: M344I

DomainStartEndE-ValueType
Pfam:ERbeta_N 31 143 4.2e-41 PFAM
ZnF_C4 165 236 1.84e-34 SMART
HOLI 319 488 5.99e-34 SMART
Blast:HOLI 489 519 7e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000133564
SMART Domains Protein: ENSMUSP00000138637
Gene: ENSMUSG00000021055

DomainStartEndE-ValueType
Pfam:ERbeta_N 31 143 1.1e-41 PFAM
ZnF_C4 165 236 1.84e-34 SMART
PDB:2J7Y|A 274 337 1e-33 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000218621
AA Change: M363I

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of estrogen receptors and superfamily of nuclear receptor transcription factors. The gene product contains an N-terminal DNA binding domain and C-terminal ligand binding domain and is localized to the nucleus, cytoplasm, and mitochondria. Upon binding to 17beta-estradiol or related ligands, the encoded protein forms homo- or hetero-dimers that interact with specific DNA sequences to activate transcription. Some isoforms dominantly inhibit the activity of other estrogen receptor family members. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neural, behavior, glucose homeostasis, sex-specific nociception, cardiac, and ion channel abnormalities and myeloproliferative disorders. Females are sterile/subfertile with granulosa cell defects; males show prostate hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
4921509C19Rik A C 2: 151,472,925 S278A possibly damaging Het
Adamts20 T C 15: 94,353,673 D411G probably damaging Het
Adgrl3 A G 5: 81,724,140 I894V possibly damaging Het
Adprhl1 C T 8: 13,223,069 V1230I probably benign Het
Agpat1 T A 17: 34,610,909 Y77N probably damaging Het
Anpep A G 7: 79,827,644 V725A possibly damaging Het
Apc T A 18: 34,312,073 I674K probably damaging Het
Arhgef2 A G 3: 88,643,955 R808G probably damaging Het
Asap1 A G 15: 64,130,256 V402A probably damaging Het
Aspg T C 12: 112,124,821 V479A possibly damaging Het
B3galnt2 G A 13: 13,994,485 V368M probably benign Het
Bahcc1 T C 11: 120,286,306 S2007P probably damaging Het
Cyfip2 A T 11: 46,196,427 I1212N possibly damaging Het
Dnajc16 A T 4: 141,763,813 D675E probably damaging Het
Dram2 T C 3: 106,555,187 F4L probably damaging Het
Dsp A G 13: 38,195,449 T2057A probably benign Het
Dync1h1 T G 12: 110,636,453 L2176R probably damaging Het
Efhb A T 17: 53,401,521 I707N possibly damaging Het
Eif2ak4 A G 2: 118,471,896 T1555A probably benign Het
Erc1 G A 6: 119,824,951 T35I possibly damaging Het
Etl4 A T 2: 20,744,189 N446I possibly damaging Het
Evpl T A 11: 116,222,956 K1303* probably null Het
Fam129c A G 8: 71,600,164 D94G probably benign Het
Fam135b A T 15: 71,463,680 V555E probably damaging Het
Fam186b A G 15: 99,280,089 L452P probably benign Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Gcc2 A G 10: 58,256,901 T48A probably benign Het
Gm12169 G A 11: 46,528,555 W66* probably null Het
Gm6619 T G 6: 131,490,391 I73S possibly damaging Het
Gm8267 T A 14: 44,722,940 D116V probably damaging Het
Gtf3c3 G A 1: 54,420,448 T385M probably benign Het
Iqgap2 C A 13: 95,628,076 M1553I probably benign Het
Kcnk1 G T 8: 125,995,568 G37C probably damaging Het
Kifc3 T C 8: 95,137,987 M32V probably benign Het
Krt81 C A 15: 101,461,370 K222N possibly damaging Het
Lrrc63 A G 14: 75,126,257 S145P possibly damaging Het
Mybbp1a T A 11: 72,451,275 V1279E probably benign Het
Olfr1044 T A 2: 86,171,010 D269V probably damaging Het
Olfr742 A T 14: 50,515,396 Y64F probably damaging Het
Pramef8 A G 4: 143,418,840 Y293C probably benign Het
Ptpn18 T C 1: 34,473,335 V407A probably benign Het
Ptpn9 T A 9: 57,027,433 Y160* probably null Het
Ptprj T C 2: 90,449,819 K1045R possibly damaging Het
Rundc3a G T 11: 102,400,046 probably null Het
Scn11a C T 9: 119,758,626 V1351I probably benign Het
Slc26a9 A G 1: 131,762,818 Y520C probably damaging Het
Spata20 G A 11: 94,484,041 A245V probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Swt1 A T 1: 151,411,064 F226I probably benign Het
Taar7f A G 10: 24,049,987 T160A possibly damaging Het
Upf2 A T 2: 6,018,932 I698F unknown Het
Vmn2r84 T C 10: 130,392,113 T85A possibly damaging Het
Zfp426 T C 9: 20,470,851 E280G possibly damaging Het
Zfp810 C A 9: 22,279,272 E78* probably null Het
Zfp937 GTGATAAGGCATTTGCACAAAACAGTCATCTCCTAACACATAAAAGAACACAT G 2: 150,238,710 probably null Het
Other mutations in Esr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Esr2 APN 12 76133896 missense probably damaging 1.00
IGL00435:Esr2 APN 12 76133879 missense probably damaging 1.00
IGL01591:Esr2 APN 12 76121724 utr 3 prime probably benign
IGL01695:Esr2 APN 12 76145319 missense probably damaging 1.00
IGL02142:Esr2 APN 12 76123195 missense probably benign 0.02
IGL02343:Esr2 APN 12 76145345 missense probably benign 0.01
IGL02584:Esr2 APN 12 76145262 missense probably damaging 1.00
R0380:Esr2 UTSW 12 76123291 missense possibly damaging 0.81
R0975:Esr2 UTSW 12 76145308 missense possibly damaging 0.49
R2075:Esr2 UTSW 12 76165447 critical splice donor site probably null
R3881:Esr2 UTSW 12 76167620 missense probably damaging 0.96
R4475:Esr2 UTSW 12 76133942 missense probably benign 0.04
R4520:Esr2 UTSW 12 76167549 missense possibly damaging 0.91
R4636:Esr2 UTSW 12 76123324 missense possibly damaging 0.50
R5167:Esr2 UTSW 12 76123274 missense probably benign 0.00
R6163:Esr2 UTSW 12 76121869 missense probably damaging 1.00
R6928:Esr2 UTSW 12 76165478 missense probably damaging 1.00
R6965:Esr2 UTSW 12 76121857 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGGCTCTTGACCCAGTAAAG -3'
(R):5'- TACCTCCCTAAGTTGTCTGGG -3'

Sequencing Primer
(F):5'- GCAATGGATAGGGTTATCATCCTC -3'
(R):5'- GTTTCCTTGGCATTTGATAACTTGC -3'
Posted On2019-10-07