Incidental Mutation 'R7441:Lrrc63'
ID576978
Institutional Source Beutler Lab
Gene Symbol Lrrc63
Ensembl Gene ENSMUSG00000021997
Gene Nameleucine rich repeat containing 63
Synonyms4921509B22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7441 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location75084303-75130881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75126257 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 145 (S145P)
Ref Sequence ENSEMBL: ENSMUSP00000022574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022574] [ENSMUST00000134114] [ENSMUST00000143539]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022574
AA Change: S145P

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022574
Gene: ENSMUSG00000021997
AA Change: S145P

DomainStartEndE-ValueType
low complexity region 15 37 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 276 310 N/A INTRINSIC
LRR 412 434 2.82e0 SMART
LRR 435 458 1.45e1 SMART
LRR 481 504 1.53e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134114
SMART Domains Protein: ENSMUSP00000121376
Gene: ENSMUSG00000021998

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143539
SMART Domains Protein: ENSMUSP00000118721
Gene: ENSMUSG00000021998

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 76 4.45e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
4921509C19Rik A C 2: 151,472,925 S278A possibly damaging Het
Adamts20 T C 15: 94,353,673 D411G probably damaging Het
Adgrl3 A G 5: 81,724,140 I894V possibly damaging Het
Adprhl1 C T 8: 13,223,069 V1230I probably benign Het
Agpat1 T A 17: 34,610,909 Y77N probably damaging Het
Anpep A G 7: 79,827,644 V725A possibly damaging Het
Apc T A 18: 34,312,073 I674K probably damaging Het
Arhgef2 A G 3: 88,643,955 R808G probably damaging Het
Asap1 A G 15: 64,130,256 V402A probably damaging Het
Aspg T C 12: 112,124,821 V479A possibly damaging Het
B3galnt2 G A 13: 13,994,485 V368M probably benign Het
Bahcc1 T C 11: 120,286,306 S2007P probably damaging Het
Cyfip2 A T 11: 46,196,427 I1212N possibly damaging Het
Dnajc16 A T 4: 141,763,813 D675E probably damaging Het
Dram2 T C 3: 106,555,187 F4L probably damaging Het
Dsp A G 13: 38,195,449 T2057A probably benign Het
Dync1h1 T G 12: 110,636,453 L2176R probably damaging Het
Efhb A T 17: 53,401,521 I707N possibly damaging Het
Eif2ak4 A G 2: 118,471,896 T1555A probably benign Het
Erc1 G A 6: 119,824,951 T35I possibly damaging Het
Esr2 C A 12: 76,141,394 M363I probably benign Het
Etl4 A T 2: 20,744,189 N446I possibly damaging Het
Evpl T A 11: 116,222,956 K1303* probably null Het
Fam129c A G 8: 71,600,164 D94G probably benign Het
Fam135b A T 15: 71,463,680 V555E probably damaging Het
Fam186b A G 15: 99,280,089 L452P probably benign Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Gcc2 A G 10: 58,256,901 T48A probably benign Het
Gm12169 G A 11: 46,528,555 W66* probably null Het
Gm6619 T G 6: 131,490,391 I73S possibly damaging Het
Gm8267 T A 14: 44,722,940 D116V probably damaging Het
Gtf3c3 G A 1: 54,420,448 T385M probably benign Het
Iqgap2 C A 13: 95,628,076 M1553I probably benign Het
Kcnk1 G T 8: 125,995,568 G37C probably damaging Het
Kifc3 T C 8: 95,137,987 M32V probably benign Het
Krt81 C A 15: 101,461,370 K222N possibly damaging Het
Mybbp1a T A 11: 72,451,275 V1279E probably benign Het
Olfr1044 T A 2: 86,171,010 D269V probably damaging Het
Olfr742 A T 14: 50,515,396 Y64F probably damaging Het
Pramef8 A G 4: 143,418,840 Y293C probably benign Het
Ptpn18 T C 1: 34,473,335 V407A probably benign Het
Ptpn9 T A 9: 57,027,433 Y160* probably null Het
Ptprj T C 2: 90,449,819 K1045R possibly damaging Het
Rundc3a G T 11: 102,400,046 probably null Het
Scn11a C T 9: 119,758,626 V1351I probably benign Het
Slc26a9 A G 1: 131,762,818 Y520C probably damaging Het
Spata20 G A 11: 94,484,041 A245V probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Swt1 A T 1: 151,411,064 F226I probably benign Het
Taar7f A G 10: 24,049,987 T160A possibly damaging Het
Upf2 A T 2: 6,018,932 I698F unknown Het
Vmn2r84 T C 10: 130,392,113 T85A possibly damaging Het
Zfp426 T C 9: 20,470,851 E280G possibly damaging Het
Zfp810 C A 9: 22,279,272 E78* probably null Het
Zfp937 GTGATAAGGCATTTGCACAAAACAGTCATCTCCTAACACATAAAAGAACACAT G 2: 150,238,710 probably null Het
Other mutations in Lrrc63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01688:Lrrc63 APN 14 75084982 missense possibly damaging 0.73
IGL02222:Lrrc63 APN 14 75086140 missense probably damaging 0.99
IGL02385:Lrrc63 APN 14 75086200 missense probably benign
FR4548:Lrrc63 UTSW 14 75125182 small deletion probably benign
FR4589:Lrrc63 UTSW 14 75125182 small deletion probably benign
R0398:Lrrc63 UTSW 14 75126470 missense probably benign 0.06
R0637:Lrrc63 UTSW 14 75098220 splice site probably benign
R0669:Lrrc63 UTSW 14 75126110 missense probably benign 0.27
R1465:Lrrc63 UTSW 14 75107389 missense possibly damaging 0.92
R1465:Lrrc63 UTSW 14 75107389 missense possibly damaging 0.92
R1478:Lrrc63 UTSW 14 75125984 missense probably benign
R1591:Lrrc63 UTSW 14 75125892 missense possibly damaging 0.92
R1753:Lrrc63 UTSW 14 75086344 splice site probably null
R3713:Lrrc63 UTSW 14 75107336 missense probably benign 0.12
R4013:Lrrc63 UTSW 14 75098291 missense probably damaging 0.98
R4793:Lrrc63 UTSW 14 75126161 missense possibly damaging 0.93
R4888:Lrrc63 UTSW 14 75125966 missense probably benign
R4937:Lrrc63 UTSW 14 75084949 missense probably damaging 0.99
R5197:Lrrc63 UTSW 14 75084882 missense possibly damaging 0.68
R5747:Lrrc63 UTSW 14 75126464 missense probably benign
R5861:Lrrc63 UTSW 14 75107366 missense possibly damaging 0.83
R5905:Lrrc63 UTSW 14 75086174 missense possibly damaging 0.92
R6028:Lrrc63 UTSW 14 75086174 missense possibly damaging 0.92
R6661:Lrrc63 UTSW 14 75125193 missense unknown
R6982:Lrrc63 UTSW 14 75084771 missense probably benign 0.33
R7062:Lrrc63 UTSW 14 75086297 missense probably benign 0.00
R7439:Lrrc63 UTSW 14 75126257 missense possibly damaging 0.84
R7440:Lrrc63 UTSW 14 75121013 missense possibly damaging 0.91
R7474:Lrrc63 UTSW 14 75126203 missense possibly damaging 0.83
R7604:Lrrc63 UTSW 14 75084969 missense possibly damaging 0.68
R7703:Lrrc63 UTSW 14 75123007 missense possibly damaging 0.91
R7819:Lrrc63 UTSW 14 75125221 small insertion probably benign
Z1088:Lrrc63 UTSW 14 75125990 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CTGAGAAGAGGGAGCTCTTGAC -3'
(R):5'- AGCACTCAAACCATCTGTCTTG -3'

Sequencing Primer
(F):5'- AGGGAGCTCTTGACTATAGCC -3'
(R):5'- GTCTTGACTATGACCATAAGGCACTC -3'
Posted On2019-10-07