Incidental Mutation 'R0628:Gramd1a'
ID57699
Institutional Source Beutler Lab
Gene Symbol Gramd1a
Ensembl Gene ENSMUSG00000001248
Gene NameGRAM domain containing 1A
SynonymsD7Bwg0611e, 1300003M23Rik
MMRRC Submission 038817-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R0628 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location31130127-31155896 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31142624 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 80 (L80P)
Ref Sequence ENSEMBL: ENSMUSP00000140674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001280] [ENSMUST00000085636] [ENSMUST00000185514] [ENSMUST00000186634] [ENSMUST00000186723] [ENSMUST00000187679]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001280
AA Change: L121P

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000001280
Gene: ENSMUSG00000001248
AA Change: L121P

DomainStartEndE-ValueType
low complexity region 8 39 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
GRAM 93 160 2.54e-29 SMART
low complexity region 342 360 N/A INTRINSIC
Pfam:DUF4782 372 520 7.3e-37 PFAM
low complexity region 531 542 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
transmembrane domain 606 628 N/A INTRINSIC
low complexity region 707 719 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085636
AA Change: L121P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082778
Gene: ENSMUSG00000001248
AA Change: L121P

DomainStartEndE-ValueType
low complexity region 8 39 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
GRAM 93 160 2.54e-29 SMART
low complexity region 342 360 N/A INTRINSIC
Pfam:DUF4782 372 500 1.1e-28 PFAM
low complexity region 514 528 N/A INTRINSIC
transmembrane domain 572 594 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185514
SMART Domains Protein: ENSMUSP00000139681
Gene: ENSMUSG00000001248

DomainStartEndE-ValueType
low complexity region 8 39 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185985
Predicted Effect probably damaging
Transcript: ENSMUST00000186634
AA Change: L121P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140195
Gene: ENSMUSG00000001248
AA Change: L121P

DomainStartEndE-ValueType
low complexity region 8 39 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
GRAM 93 160 8.9e-32 SMART
low complexity region 342 360 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186723
AA Change: L202P

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000139709
Gene: ENSMUSG00000001248
AA Change: L202P

DomainStartEndE-ValueType
low complexity region 89 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
Pfam:GRAM 174 208 1e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000187679
AA Change: L80P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140674
Gene: ENSMUSG00000001248
AA Change: L80P

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
GRAM 52 119 8.9e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188032
Predicted Effect probably benign
Transcript: ENSMUST00000202814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205298
Predicted Effect probably benign
Transcript: ENSMUST00000206233
Predicted Effect probably benign
Transcript: ENSMUST00000206432
Meta Mutation Damage Score 0.9262 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.6%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik T C 5: 109,678,576 probably null Het
Alpk2 A C 18: 65,307,296 V809G possibly damaging Het
Bank1 T A 3: 136,066,390 D493V probably damaging Het
Camk2d T C 3: 126,810,624 probably benign Het
Ccdc17 T A 4: 116,598,548 L292H probably damaging Het
Ccdc7b A G 8: 129,111,017 probably benign Het
Cd34 C A 1: 194,959,217 T317K probably damaging Het
Col6a5 C G 9: 105,912,450 probably null Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Copa T C 1: 172,091,025 probably benign Het
Coq7 T C 7: 118,529,644 D56G probably damaging Het
Dlg4 C T 11: 70,031,784 T201I probably damaging Het
Dnah7a T A 1: 53,497,105 D2593V probably benign Het
Ect2l T A 10: 18,143,040 E536V probably damaging Het
Emilin3 A G 2: 160,910,879 probably benign Het
Eml2 T C 7: 19,201,554 probably benign Het
Fam135b C T 15: 71,448,656 probably benign Het
Fam160b2 T C 14: 70,587,721 T392A possibly damaging Het
Gart C T 16: 91,633,902 R424H probably benign Het
Gm9745 T A 13: 8,940,922 probably benign Het
Herc1 A G 9: 66,450,881 K2415E probably benign Het
Ica1 C T 6: 8,644,256 probably benign Het
Iyd A T 10: 3,547,127 M161L probably damaging Het
Kdm5a T C 6: 120,415,239 L974S probably damaging Het
Kif1a T C 1: 93,019,883 D1619G probably damaging Het
Lypd8 C T 11: 58,384,673 T78M probably damaging Het
March10 T A 11: 105,390,160 H433L probably benign Het
Mbp A G 18: 82,554,617 Y13C probably damaging Het
Mertk A T 2: 128,738,313 N229I probably damaging Het
Msrb2 T A 2: 19,393,280 D116E probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Otoa G A 7: 121,145,650 probably benign Het
Pclo A G 5: 14,669,538 T1230A unknown Het
Polrmt T C 10: 79,739,145 T851A possibly damaging Het
Prpf6 C T 2: 181,636,048 P401L probably damaging Het
Rasgrp4 A G 7: 29,140,210 probably benign Het
Rc3h2 A T 2: 37,382,052 probably benign Het
Reps1 A G 10: 18,121,093 T588A probably damaging Het
Rtel1 A C 2: 181,351,881 S782R probably benign Het
Sacm1l A G 9: 123,548,995 probably benign Het
Skint5 A T 4: 113,731,069 L728* probably null Het
Slc9b2 T A 3: 135,323,775 probably benign Het
Snapc3 A T 4: 83,450,160 H298L probably benign Het
Tex9 A T 9: 72,491,951 M1K probably null Het
Trappc13 C T 13: 104,154,916 probably benign Het
Ttc37 G C 13: 76,150,729 V1185L possibly damaging Het
Usp3 C T 9: 66,518,444 R467H probably benign Het
Vmn2r11 T A 5: 109,047,731 L576F possibly damaging Het
Wnk4 T C 11: 101,275,023 F792S probably benign Het
Zfp280d T C 9: 72,361,948 V764A probably benign Het
Zfp69 G A 4: 120,949,425 Q4* probably null Het
Zfp692 T G 11: 58,309,623 L206R probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Zic4 T A 9: 91,384,117 Y264* probably null Het
Zic4 T A 9: 91,384,119 M272K probably benign Het
Zscan4b A T 7: 10,901,463 N284K probably damaging Het
Other mutations in Gramd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Gramd1a APN 7 31142568 missense probably damaging 0.99
IGL01627:Gramd1a APN 7 31139796 missense probably damaging 0.99
IGL01684:Gramd1a APN 7 31138905 missense possibly damaging 0.67
IGL01793:Gramd1a APN 7 31134413 critical splice donor site probably null
IGL01986:Gramd1a APN 7 31134009 missense possibly damaging 0.58
IGL02029:Gramd1a APN 7 31132824 missense possibly damaging 0.95
IGL02060:Gramd1a APN 7 31130571 nonsense probably null
IGL02569:Gramd1a APN 7 31130507 unclassified probably benign
IGL02606:Gramd1a APN 7 31134515 missense probably damaging 1.00
IGL02715:Gramd1a APN 7 31135854 missense probably damaging 1.00
IGL03253:Gramd1a APN 7 31139846 nonsense probably null
PIT4377001:Gramd1a UTSW 7 31143670 missense possibly damaging 0.95
PIT4618001:Gramd1a UTSW 7 31132596 missense probably benign 0.00
R0179:Gramd1a UTSW 7 31142418 missense probably damaging 1.00
R0329:Gramd1a UTSW 7 31138254 missense possibly damaging 0.93
R0330:Gramd1a UTSW 7 31138254 missense possibly damaging 0.93
R0834:Gramd1a UTSW 7 31138164 missense possibly damaging 0.94
R1421:Gramd1a UTSW 7 31142866 missense probably damaging 0.98
R1430:Gramd1a UTSW 7 31132786 missense probably damaging 0.97
R1682:Gramd1a UTSW 7 31142900 splice site probably null
R1703:Gramd1a UTSW 7 31139534 missense possibly damaging 0.96
R1822:Gramd1a UTSW 7 31142573 missense probably damaging 1.00
R2308:Gramd1a UTSW 7 31139790 missense probably damaging 0.97
R3861:Gramd1a UTSW 7 31135940 missense possibly damaging 0.90
R4184:Gramd1a UTSW 7 31132515 intron probably benign
R4908:Gramd1a UTSW 7 31138867 missense probably benign 0.27
R4978:Gramd1a UTSW 7 31132788 missense possibly damaging 0.74
R5723:Gramd1a UTSW 7 31134483 missense probably damaging 1.00
R5927:Gramd1a UTSW 7 31139821 missense probably benign 0.33
R6466:Gramd1a UTSW 7 31143796 missense probably benign
R6838:Gramd1a UTSW 7 31134504 missense probably benign 0.30
R7034:Gramd1a UTSW 7 31132756 critical splice donor site probably null
R7036:Gramd1a UTSW 7 31132756 critical splice donor site probably null
R7867:Gramd1a UTSW 7 31143567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGTCACTTCCTTCAACTGGATGG -3'
(R):5'- AAACTTCCTGAAGCAGAGCGCC -3'

Sequencing Primer
(F):5'- CACTTCCTTCAACTGGATGGAAATC -3'
(R):5'- TGAAGCAGAGCGCCTCATC -3'
Posted On2013-07-11