Incidental Mutation 'R7442:Anapc4'
ID577007
Institutional Source Beutler Lab
Gene Symbol Anapc4
Ensembl Gene ENSMUSG00000029176
Gene Nameanaphase promoting complex subunit 4
Synonyms2610306D21Rik, D5Ertd249e, APC4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7442 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location52834012-52867797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52857201 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 469 (Y469H)
Ref Sequence ENSEMBL: ENSMUSP00000031072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031072] [ENSMUST00000144574]
Predicted Effect probably benign
Transcript: ENSMUST00000031072
AA Change: Y469H

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000031072
Gene: ENSMUSG00000029176
AA Change: Y469H

DomainStartEndE-ValueType
Pfam:ANAPC4_WD40 10 57 9.1e-18 PFAM
low complexity region 137 147 N/A INTRINSIC
Pfam:ANAPC4 232 431 3.7e-61 PFAM
low complexity region 747 763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144574
SMART Domains Protein: ENSMUSP00000114475
Gene: ENSMUSG00000029176

DomainStartEndE-ValueType
Pfam:Apc4_WD40 10 57 4e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A large protein complex, termed the anaphase-promoting complex (APC), or the cyclosome, promotes metaphase-anaphase transition by ubiquitinating its specific substrates such as mitotic cyclins and anaphase inhibitor, which are subsequently degraded by the 26S proteasome. Biochemical studies have shown that the vertebrate APC contains eight subunits. The composition of the APC is highly conserved in organisms from yeast to humans. The exact function of this gene product is not known. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,220,290 I109T probably damaging Het
A430033K04Rik T C 5: 138,647,247 S465P possibly damaging Het
Acap3 T C 4: 155,905,621 F753L probably damaging Het
Adam9 A T 8: 24,967,207 V635E probably damaging Het
Adgre4 T A 17: 55,852,340 V675E probably benign Het
Ankdd1b T G 13: 96,424,760 K325N possibly damaging Het
Aox1 T C 1: 58,082,013 V881A probably damaging Het
Arhgap5 A G 12: 52,516,956 T237A probably benign Het
Asah1 T C 8: 41,343,565 D331G possibly damaging Het
Atp5a1 G A 18: 77,779,120 R231H probably benign Het
Bod1l G A 5: 41,807,179 P2694L probably damaging Het
Bst1 T C 5: 43,821,742 S143P probably benign Het
Cacna1b A C 2: 24,607,501 S2132A probably benign Het
Caps2 G T 10: 112,208,354 R486L probably damaging Het
Cd68 T C 11: 69,665,928 T18A probably benign Het
Cdk8 T C 5: 146,292,769 probably null Het
Col18a1 A T 10: 77,096,238 I127N unknown Het
Dsc3 T C 18: 19,981,156 D347G probably damaging Het
Dusp27 T C 1: 166,101,015 K343E probably benign Het
Dyrk2 T C 10: 118,859,881 S491G probably damaging Het
Edem1 T A 6: 108,851,305 Y530* probably null Het
Enc1 A T 13: 97,246,740 H586L probably benign Het
Ephb6 T G 6: 41,618,047 probably null Het
Etv5 G T 16: 22,436,059 Q48K probably damaging Het
Exoc3l A G 8: 105,292,926 W404R probably damaging Het
Fbn1 C A 2: 125,403,212 A252S possibly damaging Het
Foxe3 A G 4: 114,925,293 S241P unknown Het
Gm49380 T A 9: 44,112,412 M180L probably benign Het
Gm8251 A G 1: 44,058,708 S1077P possibly damaging Het
Hoxd1 A T 2: 74,763,559 D153V probably damaging Het
Ifi207 C T 1: 173,727,431 S895N probably benign Het
Igf1r G A 7: 68,173,278 V385M probably damaging Het
Ints9 C T 14: 64,995,064 Q191* probably null Het
Ktn1 A G 14: 47,714,640 E979G probably benign Het
Lama3 G A 18: 12,472,181 probably null Het
Lrtm2 C T 6: 119,317,431 M246I probably damaging Het
Mdm1 T C 10: 118,146,685 V75A probably benign Het
Mia3 T C 1: 183,358,876 E165G probably benign Het
Mrps21 T C 3: 95,862,816 E67G probably damaging Het
Mybpc1 A C 10: 88,526,293 I995S probably damaging Het
Mylk2 T G 2: 152,911,426 probably benign Het
Myo16 G A 8: 10,272,537 C11Y probably damaging Het
Nudt18 A C 14: 70,579,358 D134A probably benign Het
Obox1 G T 7: 15,555,566 K93N probably benign Het
Olfr1019 A T 2: 85,841,752 V13D probably benign Het
Olfr102 T A 17: 37,313,925 H153L possibly damaging Het
Olfr457 A T 6: 42,471,500 M226K probably benign Het
Olfr684 T C 7: 105,157,082 Y200C probably damaging Het
Pkd2l1 T C 19: 44,157,229 H185R probably benign Het
Ptpn18 A G 1: 34,462,750 T48A probably benign Het
Ptprd A T 4: 76,059,821 Y583* probably null Het
Ptprk G A 10: 28,574,819 G992D probably damaging Het
Setdb2 A G 14: 59,419,251 F206L probably damaging Het
Slain1 A G 14: 103,685,714 D247G probably damaging Het
Slc10a2 A T 8: 5,089,086 V286E possibly damaging Het
Slc44a2 C T 9: 21,345,523 T367I probably damaging Het
Slco4a1 T C 2: 180,474,126 V685A probably benign Het
Srp54c T A 12: 55,255,562 Y333N probably damaging Het
Srrm2 T C 17: 23,820,117 S1912P unknown Het
St7l A G 3: 104,889,329 T253A possibly damaging Het
Sun3 T G 11: 9,031,445 Y53S possibly damaging Het
Tktl2 A G 8: 66,512,909 N373S possibly damaging Het
Tmco3 T A 8: 13,320,781 S648R probably damaging Het
Tmem178 T A 17: 80,944,756 V23D probably damaging Het
Tmem229a C A 6: 24,955,690 G22W probably damaging Het
Top3a C T 11: 60,753,918 S320N possibly damaging Het
Treml1 C A 17: 48,366,691 D243E probably damaging Het
Trim42 C T 9: 97,362,945 V601M probably damaging Het
Ttn A G 2: 76,743,006 S25848P probably damaging Het
Vmn1r86 A T 7: 13,102,056 F298I possibly damaging Het
Vmn2r96 T C 17: 18,573,400 F2S probably benign Het
Xpc A G 6: 91,504,649 L230P probably damaging Het
Xpo4 A G 14: 57,630,223 V189A probably benign Het
Zfhx3 A G 8: 108,792,836 T197A probably damaging Het
Zswim1 A G 2: 164,825,790 K321E probably damaging Het
Other mutations in Anapc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Anapc4 APN 5 52857211 missense probably damaging 0.98
IGL01066:Anapc4 APN 5 52857209 missense probably benign 0.08
IGL01109:Anapc4 APN 5 52848628 missense probably damaging 1.00
IGL01657:Anapc4 APN 5 52864626 nonsense probably null
IGL02692:Anapc4 APN 5 52864529 missense probably damaging 0.98
IGL02734:Anapc4 APN 5 52861291 missense probably benign 0.04
IGL03089:Anapc4 APN 5 52866398 missense probably benign 0.32
IGL03096:Anapc4 APN 5 52865929 missense possibly damaging 0.57
FR4304:Anapc4 UTSW 5 52864526 missense probably damaging 1.00
IGL03048:Anapc4 UTSW 5 52839733 missense probably benign 0.00
R0331:Anapc4 UTSW 5 52855642 splice site probably benign
R0511:Anapc4 UTSW 5 52842017 unclassified probably benign
R0624:Anapc4 UTSW 5 52845419 splice site probably benign
R0919:Anapc4 UTSW 5 52855637 missense probably benign 0.18
R1935:Anapc4 UTSW 5 52839668 missense probably damaging 0.99
R1936:Anapc4 UTSW 5 52839668 missense probably damaging 0.99
R1942:Anapc4 UTSW 5 52846714 missense probably benign 0.30
R1953:Anapc4 UTSW 5 52839688 missense probably damaging 1.00
R1954:Anapc4 UTSW 5 52846625 intron probably benign
R2341:Anapc4 UTSW 5 52841937 unclassified probably benign
R3696:Anapc4 UTSW 5 52862009 missense probably null 0.01
R4506:Anapc4 UTSW 5 52835730 missense possibly damaging 0.79
R4596:Anapc4 UTSW 5 52841718 missense probably benign 0.00
R5234:Anapc4 UTSW 5 52848776 missense probably damaging 1.00
R5256:Anapc4 UTSW 5 52863594 missense probably benign
R5310:Anapc4 UTSW 5 52859159 missense probably benign 0.00
R5401:Anapc4 UTSW 5 52863649 missense probably benign 0.01
R5409:Anapc4 UTSW 5 52848599 missense probably damaging 0.98
R5525:Anapc4 UTSW 5 52856809 missense probably damaging 1.00
R5575:Anapc4 UTSW 5 52855871 missense probably damaging 1.00
R5604:Anapc4 UTSW 5 52841734 nonsense probably null
R5695:Anapc4 UTSW 5 52862239 missense probably benign 0.00
R5955:Anapc4 UTSW 5 52865946 missense probably benign 0.01
R5974:Anapc4 UTSW 5 52845400 missense probably damaging 1.00
R6458:Anapc4 UTSW 5 52864553 missense possibly damaging 0.80
R6537:Anapc4 UTSW 5 52843556 missense probably damaging 0.98
R6633:Anapc4 UTSW 5 52865946 missense possibly damaging 0.85
R6860:Anapc4 UTSW 5 52848828 missense probably damaging 1.00
R6965:Anapc4 UTSW 5 52835751 missense possibly damaging 0.89
R7067:Anapc4 UTSW 5 52862235 missense probably benign
R7327:Anapc4 UTSW 5 52845330 missense probably damaging 0.99
R7837:Anapc4 UTSW 5 52859208 critical splice donor site probably null
R7920:Anapc4 UTSW 5 52859208 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTTCCTTAGAAAACTCGTCTGC -3'
(R):5'- ACACTTGACTTAAAGAGTTTGGGG -3'

Sequencing Primer
(F):5'- AAAACTCGTCTGCTTCTCTTTGTGAG -3'
(R):5'- GGTCATCTTACTAAAAAGGCAGAC -3'
Posted On2019-10-07