Mutagenetix > Incidental Mutation

Incidental Mutation 'R7442:Anapc4'

577007

Institutional Source

Beutler Lab

Gene Symbol

Anapc4

Ensembl Gene

ENSMUSG00000029176

Gene Name

anaphase promoting complex subunit 4

Synonyms

2610306D21Rik, D5Ertd249e, APC4

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7442 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

52834012-52867797 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 52857201 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 469 (Y469H)

Ref Sequence

ENSEMBL: ENSMUSP00000031072 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031072] [ENSMUST00000144574]

AlphaFold

Q91W96

Predicted Effect

probably benign
Transcript: ENSMUST00000031072
AA Change: Y469H

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000031072
Gene: ENSMUSG00000029176
AA Change: Y469H

Domain	Start	End	E-Value	Type
Pfam:ANAPC4_WD40	10	57	9.1e-18	PFAM
low complexity region	137	147	N/A	INTRINSIC
Pfam:ANAPC4	232	431	3.7e-61	PFAM
low complexity region	747	763	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000144574

SMART Domains

Protein: ENSMUSP00000114475
Gene: ENSMUSG00000029176

Domain	Start	End	E-Value	Type
Pfam:Apc4_WD40	10	57	4e-20	PFAM

Meta Mutation Damage Score

0.1049

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (76/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A large protein complex, termed the anaphase-promoting complex (APC), or the cyclosome, promotes metaphase-anaphase transition by ubiquitinating its specific substrates such as mitotic cyclins and anaphase inhibitor, which are subsequently degraded by the 26S proteasome. Biochemical studies have shown that the vertebrate APC contains eight subunits. The composition of the APC is highly conserved in organisms from yeast to humans. The exact function of this gene product is not known. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011L22Rik	A	G	8: 79,220,290	I109T	probably damaging	Het
A430033K04Rik	T	C	5: 138,647,247	S465P	possibly damaging	Het
Acap3	T	C	4: 155,905,621	F753L	probably damaging	Het
Adam9	A	T	8: 24,967,207	V635E	probably damaging	Het
Adgre4	T	A	17: 55,852,340	V675E	probably benign	Het
Ankdd1b	T	G	13: 96,424,760	K325N	possibly damaging	Het
Aox1	T	C	1: 58,082,013	V881A	probably damaging	Het
Arhgap5	A	G	12: 52,516,956	T237A	probably benign	Het
Asah1	T	C	8: 41,343,565	D331G	possibly damaging	Het
Atp5a1	G	A	18: 77,779,120	R231H	probably benign	Het
Bod1l	G	A	5: 41,807,179	P2694L	probably damaging	Het
Bst1	T	C	5: 43,821,742	S143P	probably benign	Het
Cacna1b	A	C	2: 24,607,501	S2132A	probably benign	Het
Caps2	G	T	10: 112,208,354	R486L	probably damaging	Het
Cd68	T	C	11: 69,665,928	T18A	probably benign	Het
Cdk8	T	C	5: 146,292,769		probably null	Het
Col18a1	A	T	10: 77,096,238	I127N	unknown	Het
Dsc3	T	C	18: 19,981,156	D347G	probably damaging	Het
Dusp27	T	C	1: 166,101,015	K343E	probably benign	Het
Dyrk2	T	C	10: 118,859,881	S491G	probably damaging	Het
Edem1	T	A	6: 108,851,305	Y530*	probably null	Het
Enc1	A	T	13: 97,246,740	H586L	probably benign	Het
Ephb6	T	G	6: 41,618,047		probably null	Het
Etv5	G	T	16: 22,436,059	Q48K	probably damaging	Het
Exoc3l	A	G	8: 105,292,926	W404R	probably damaging	Het
Fbn1	C	A	2: 125,403,212	A252S	possibly damaging	Het
Foxe3	A	G	4: 114,925,293	S241P	unknown	Het
Gm49380	T	A	9: 44,112,412	M180L	probably benign	Het
Gm8251	A	G	1: 44,058,708	S1077P	possibly damaging	Het
Hoxd1	A	T	2: 74,763,559	D153V	probably damaging	Het
Ifi207	C	T	1: 173,727,431	S895N	probably benign	Het
Igf1r	G	A	7: 68,173,278	V385M	probably damaging	Het
Ints9	C	T	14: 64,995,064	Q191*	probably null	Het
Ktn1	A	G	14: 47,714,640	E979G	probably benign	Het
Lama3	G	A	18: 12,472,181		probably null	Het
Lrtm2	C	T	6: 119,317,431	M246I	probably damaging	Het
Mdm1	T	C	10: 118,146,685	V75A	probably benign	Het
Mia3	T	C	1: 183,358,876	E165G	probably benign	Het
Mrps21	T	C	3: 95,862,816	E67G	probably damaging	Het
Mybpc1	A	C	10: 88,526,293	I995S	probably damaging	Het
Mylk2	T	G	2: 152,911,426		probably benign	Het
Myo16	G	A	8: 10,272,537	C11Y	probably damaging	Het
Nudt18	A	C	14: 70,579,358	D134A	probably benign	Het
Obox1	G	T	7: 15,555,566	K93N	probably benign	Het
Olfr1019	A	T	2: 85,841,752	V13D	probably benign	Het
Olfr102	T	A	17: 37,313,925	H153L	possibly damaging	Het
Olfr457	A	T	6: 42,471,500	M226K	probably benign	Het
Olfr684	T	C	7: 105,157,082	Y200C	probably damaging	Het
Pkd2l1	T	C	19: 44,157,229	H185R	probably benign	Het
Ptpn18	A	G	1: 34,462,750	T48A	probably benign	Het
Ptprd	A	T	4: 76,059,821	Y583*	probably null	Het
Ptprk	G	A	10: 28,574,819	G992D	probably damaging	Het
Setdb2	A	G	14: 59,419,251	F206L	probably damaging	Het
Slain1	A	G	14: 103,685,714	D247G	probably damaging	Het
Slc10a2	A	T	8: 5,089,086	V286E	possibly damaging	Het
Slc44a2	C	T	9: 21,345,523	T367I	probably damaging	Het
Slco4a1	T	C	2: 180,474,126	V685A	probably benign	Het
Srp54c	T	A	12: 55,255,562	Y333N	probably damaging	Het
Srrm2	T	C	17: 23,820,117	S1912P	unknown	Het
St7l	A	G	3: 104,889,329	T253A	possibly damaging	Het
Sun3	T	G	11: 9,031,445	Y53S	possibly damaging	Het
Tktl2	A	G	8: 66,512,909	N373S	possibly damaging	Het
Tmco3	T	A	8: 13,320,781	S648R	probably damaging	Het
Tmem178	T	A	17: 80,944,756	V23D	probably damaging	Het
Tmem229a	C	A	6: 24,955,690	G22W	probably damaging	Het
Top3a	C	T	11: 60,753,918	S320N	possibly damaging	Het
Treml1	C	A	17: 48,366,691	D243E	probably damaging	Het
Trim42	C	T	9: 97,362,945	V601M	probably damaging	Het
Ttn	A	G	2: 76,743,006	S25848P	probably damaging	Het
Vmn1r86	A	T	7: 13,102,056	F298I	possibly damaging	Het
Vmn2r96	T	C	17: 18,573,400	F2S	probably benign	Het
Xpc	A	G	6: 91,504,649	L230P	probably damaging	Het
Xpo4	A	G	14: 57,630,223	V189A	probably benign	Het
Zfhx3	A	G	8: 108,792,836	T197A	probably damaging	Het
Zswim1	A	G	2: 164,825,790	K321E	probably damaging	Het

Other mutations in Anapc4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00801:Anapc4	APN	5	52857211	missense	probably damaging	0.98
IGL01066:Anapc4	APN	5	52857209	missense	probably benign	0.08
IGL01109:Anapc4	APN	5	52848628	missense	probably damaging	1.00
IGL01657:Anapc4	APN	5	52864626	nonsense	probably null
IGL02692:Anapc4	APN	5	52864529	missense	probably damaging	0.98
IGL02734:Anapc4	APN	5	52861291	missense	probably benign	0.04
IGL03089:Anapc4	APN	5	52866398	missense	probably benign	0.32
IGL03096:Anapc4	APN	5	52865929	missense	possibly damaging	0.57
FR4304:Anapc4	UTSW	5	52864526	missense	probably damaging	1.00
IGL03048:Anapc4	UTSW	5	52839733	missense	probably benign	0.00
R0331:Anapc4	UTSW	5	52855642	splice site	probably benign
R0511:Anapc4	UTSW	5	52842017	unclassified	probably benign
R0624:Anapc4	UTSW	5	52845419	splice site	probably benign
R0919:Anapc4	UTSW	5	52855637	missense	probably benign	0.18
R1935:Anapc4	UTSW	5	52839668	missense	probably damaging	0.99
R1936:Anapc4	UTSW	5	52839668	missense	probably damaging	0.99
R1942:Anapc4	UTSW	5	52846714	missense	probably benign	0.30
R1953:Anapc4	UTSW	5	52839688	missense	probably damaging	1.00
R1954:Anapc4	UTSW	5	52846625	intron	probably benign
R2341:Anapc4	UTSW	5	52841937	unclassified	probably benign
R3696:Anapc4	UTSW	5	52862009	missense	probably null	0.01
R4506:Anapc4	UTSW	5	52835730	missense	possibly damaging	0.79
R4596:Anapc4	UTSW	5	52841718	missense	probably benign	0.00
R5234:Anapc4	UTSW	5	52848776	missense	probably damaging	1.00
R5256:Anapc4	UTSW	5	52863594	missense	probably benign
R5310:Anapc4	UTSW	5	52859159	missense	probably benign	0.00
R5401:Anapc4	UTSW	5	52863649	missense	probably benign	0.01
R5409:Anapc4	UTSW	5	52848599	missense	probably damaging	0.98
R5525:Anapc4	UTSW	5	52856809	missense	probably damaging	1.00
R5575:Anapc4	UTSW	5	52855871	missense	probably damaging	1.00
R5604:Anapc4	UTSW	5	52841734	nonsense	probably null
R5695:Anapc4	UTSW	5	52862239	missense	probably benign	0.00
R5955:Anapc4	UTSW	5	52865946	missense	probably benign	0.01
R5974:Anapc4	UTSW	5	52845400	missense	probably damaging	1.00
R6458:Anapc4	UTSW	5	52864553	missense	possibly damaging	0.80
R6537:Anapc4	UTSW	5	52843556	missense	probably damaging	0.98
R6633:Anapc4	UTSW	5	52865946	missense	possibly damaging	0.85
R6860:Anapc4	UTSW	5	52848828	missense	probably damaging	1.00
R6965:Anapc4	UTSW	5	52835751	missense	possibly damaging	0.89
R7067:Anapc4	UTSW	5	52862235	missense	probably benign
R7327:Anapc4	UTSW	5	52845330	missense	probably damaging	0.99
R7837:Anapc4	UTSW	5	52859208	critical splice donor site	probably null
R8382:Anapc4	UTSW	5	52858935	splice site	probably null
R8840:Anapc4	UTSW	5	52859131	missense	probably damaging	0.98
R8914:Anapc4	UTSW	5	52843501	nonsense	probably null
R8972:Anapc4	UTSW	5	52850542	missense	possibly damaging	0.88
R9037:Anapc4	UTSW	5	52864501	missense	probably benign	0.16
R9211:Anapc4	UTSW	5	52850652	missense	possibly damaging	0.74
R9269:Anapc4	UTSW	5	52861278	missense	possibly damaging	0.92
R9294:Anapc4	UTSW	5	52864525	missense	possibly damaging	0.64

Predicted Primers

PCR Primer
(F):5'- ACTTCCTTAGAAAACTCGTCTGC -3'
(R):5'- ACACTTGACTTAAAGAGTTTGGGG -3'

Sequencing Primer
(F):5'- AAAACTCGTCTGCTTCTCTTTGTGAG -3'
(R):5'- GGTCATCTTACTAAAAAGGCAGAC -3'

Posted On

2019-10-07