Incidental Mutation 'R7442:Xpc'
ID577012
Institutional Source Beutler Lab
Gene Symbol Xpc
Ensembl Gene ENSMUSG00000030094
Gene Namexeroderma pigmentosum, complementation group C
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.445) question?
Stock #R7442 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location91489305-91515888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91504649 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 230 (L230P)
Ref Sequence ENSEMBL: ENSMUSP00000032182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032182] [ENSMUST00000206476]
Predicted Effect probably damaging
Transcript: ENSMUST00000032182
AA Change: L230P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032182
Gene: ENSMUSG00000030094
AA Change: L230P

DomainStartEndE-ValueType
low complexity region 69 82 N/A INTRINSIC
low complexity region 106 115 N/A INTRINSIC
low complexity region 118 142 N/A INTRINSIC
low complexity region 299 315 N/A INTRINSIC
low complexity region 335 352 N/A INTRINSIC
low complexity region 371 387 N/A INTRINSIC
low complexity region 425 439 N/A INTRINSIC
Pfam:Rad4 485 619 6.4e-26 PFAM
BHD_1 623 675 4.09e-25 SMART
BHD_2 677 737 4.96e-24 SMART
BHD_3 744 818 4.83e-45 SMART
low complexity region 826 835 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000206476
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the nucleotide excision repair (NER) pathway. There are multiple components involved in the NER pathway, including Xeroderma pigmentosum (XP) A-G and V, Cockayne syndrome (CS) A and B, and trichothiodystrophy (TTD) group A, etc. This component, XPC, plays an important role in the early steps of global genome NER, especially in damage recognition, open complex formation, and repair protein complex formation. Mutations in this gene or some other NER components result in Xeroderma pigmentosum, a rare autosomal recessive disorder characterized by increased sensitivity to sunlight with the development of carcinomas at an early age. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous mutants are highly susceptible to ultraviolet-induced skin tumors and exhibit a 30-fold higher somatic frequency of gene mutations at one year of age. Mutant cells exhibit impaired nucleotide excision repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,220,290 I109T probably damaging Het
A430033K04Rik T C 5: 138,647,247 S465P possibly damaging Het
Acap3 T C 4: 155,905,621 F753L probably damaging Het
Adam9 A T 8: 24,967,207 V635E probably damaging Het
Adgre4 T A 17: 55,852,340 V675E probably benign Het
Anapc4 T C 5: 52,857,201 Y469H probably benign Het
Ankdd1b T G 13: 96,424,760 K325N possibly damaging Het
Aox1 T C 1: 58,082,013 V881A probably damaging Het
Arhgap5 A G 12: 52,516,956 T237A probably benign Het
Asah1 T C 8: 41,343,565 D331G possibly damaging Het
Atp5a1 G A 18: 77,779,120 R231H probably benign Het
Bod1l G A 5: 41,807,179 P2694L probably damaging Het
Bst1 T C 5: 43,821,742 S143P probably benign Het
Cacna1b A C 2: 24,607,501 S2132A probably benign Het
Caps2 G T 10: 112,208,354 R486L probably damaging Het
Cd68 T C 11: 69,665,928 T18A probably benign Het
Cdk8 T C 5: 146,292,769 probably null Het
Col18a1 A T 10: 77,096,238 I127N unknown Het
Dsc3 T C 18: 19,981,156 D347G probably damaging Het
Dusp27 T C 1: 166,101,015 K343E probably benign Het
Dyrk2 T C 10: 118,859,881 S491G probably damaging Het
Edem1 T A 6: 108,851,305 Y530* probably null Het
Enc1 A T 13: 97,246,740 H586L probably benign Het
Ephb6 T G 6: 41,618,047 probably null Het
Etv5 G T 16: 22,436,059 Q48K probably damaging Het
Exoc3l A G 8: 105,292,926 W404R probably damaging Het
Fbn1 C A 2: 125,403,212 A252S possibly damaging Het
Foxe3 A G 4: 114,925,293 S241P unknown Het
Gm49380 T A 9: 44,112,412 M180L probably benign Het
Gm8251 A G 1: 44,058,708 S1077P possibly damaging Het
Hoxd1 A T 2: 74,763,559 D153V probably damaging Het
Ifi207 C T 1: 173,727,431 S895N probably benign Het
Igf1r G A 7: 68,173,278 V385M probably damaging Het
Ints9 C T 14: 64,995,064 Q191* probably null Het
Ktn1 A G 14: 47,714,640 E979G probably benign Het
Lama3 G A 18: 12,472,181 probably null Het
Lrtm2 C T 6: 119,317,431 M246I probably damaging Het
Mdm1 T C 10: 118,146,685 V75A probably benign Het
Mia3 T C 1: 183,358,876 E165G probably benign Het
Mrps21 T C 3: 95,862,816 E67G probably damaging Het
Mybpc1 A C 10: 88,526,293 I995S probably damaging Het
Mylk2 T G 2: 152,911,426 probably benign Het
Myo16 G A 8: 10,272,537 C11Y probably damaging Het
Nudt18 A C 14: 70,579,358 D134A probably benign Het
Obox1 G T 7: 15,555,566 K93N probably benign Het
Olfr1019 A T 2: 85,841,752 V13D probably benign Het
Olfr102 T A 17: 37,313,925 H153L possibly damaging Het
Olfr457 A T 6: 42,471,500 M226K probably benign Het
Olfr684 T C 7: 105,157,082 Y200C probably damaging Het
Pkd2l1 T C 19: 44,157,229 H185R probably benign Het
Ptpn18 A G 1: 34,462,750 T48A probably benign Het
Ptprd A T 4: 76,059,821 Y583* probably null Het
Ptprk G A 10: 28,574,819 G992D probably damaging Het
Setdb2 A G 14: 59,419,251 F206L probably damaging Het
Slain1 A G 14: 103,685,714 D247G probably damaging Het
Slc10a2 A T 8: 5,089,086 V286E possibly damaging Het
Slc44a2 C T 9: 21,345,523 T367I probably damaging Het
Slco4a1 T C 2: 180,474,126 V685A probably benign Het
Srp54c T A 12: 55,255,562 Y333N probably damaging Het
Srrm2 T C 17: 23,820,117 S1912P unknown Het
St7l A G 3: 104,889,329 T253A possibly damaging Het
Sun3 T G 11: 9,031,445 Y53S possibly damaging Het
Tktl2 A G 8: 66,512,909 N373S possibly damaging Het
Tmco3 T A 8: 13,320,781 S648R probably damaging Het
Tmem178 T A 17: 80,944,756 V23D probably damaging Het
Tmem229a C A 6: 24,955,690 G22W probably damaging Het
Top3a C T 11: 60,753,918 S320N possibly damaging Het
Treml1 C A 17: 48,366,691 D243E probably damaging Het
Trim42 C T 9: 97,362,945 V601M probably damaging Het
Ttn A G 2: 76,743,006 S25848P probably damaging Het
Vmn1r86 A T 7: 13,102,056 F298I possibly damaging Het
Vmn2r96 T C 17: 18,573,400 F2S probably benign Het
Xpo4 A G 14: 57,630,223 V189A probably benign Het
Zfhx3 A G 8: 108,792,836 T197A probably damaging Het
Zswim1 A G 2: 164,825,790 K321E probably damaging Het
Other mutations in Xpc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Xpc APN 6 91492264 unclassified probably benign
IGL01108:Xpc APN 6 91493005 missense probably damaging 1.00
IGL01310:Xpc APN 6 91490107 missense probably benign 0.02
IGL01323:Xpc APN 6 91492353 missense probably damaging 1.00
IGL01350:Xpc APN 6 91500011 missense probably benign 0.01
IGL01656:Xpc APN 6 91505467 missense probably damaging 0.98
IGL01922:Xpc APN 6 91505425 missense probably damaging 1.00
IGL02412:Xpc APN 6 91499785 missense probably benign 0.01
IGL02448:Xpc APN 6 91515744 missense probably benign 0.00
IGL02571:Xpc APN 6 91504071 missense probably benign 0.00
IGL02937:Xpc APN 6 91500137 missense probably damaging 1.00
IGL02951:Xpc APN 6 91506849 missense probably damaging 1.00
IGL03033:Xpc APN 6 91491315 splice site probably null
IGL03248:Xpc APN 6 91504583 missense probably damaging 0.99
IGL03046:Xpc UTSW 6 91510481 missense probably damaging 1.00
R0031:Xpc UTSW 6 91491226 missense probably benign 0.01
R0173:Xpc UTSW 6 91504735 unclassified probably benign
R0285:Xpc UTSW 6 91498064 missense probably damaging 0.99
R0454:Xpc UTSW 6 91491226 missense probably benign 0.01
R0535:Xpc UTSW 6 91504578 missense possibly damaging 0.92
R0554:Xpc UTSW 6 91491226 missense probably benign 0.01
R0759:Xpc UTSW 6 91498142 missense probably damaging 0.99
R1426:Xpc UTSW 6 91493238 missense probably damaging 1.00
R1478:Xpc UTSW 6 91508528 missense possibly damaging 0.94
R1676:Xpc UTSW 6 91492947 missense possibly damaging 0.56
R1969:Xpc UTSW 6 91501025 splice site probably null
R2138:Xpc UTSW 6 91498122 nonsense probably null
R2237:Xpc UTSW 6 91498108 missense probably damaging 1.00
R4580:Xpc UTSW 6 91500011 missense probably benign 0.01
R5318:Xpc UTSW 6 91493010 missense probably damaging 1.00
R5567:Xpc UTSW 6 91498135 missense probably damaging 1.00
R5681:Xpc UTSW 6 91504120 missense probably damaging 1.00
R6022:Xpc UTSW 6 91499636 missense probably damaging 0.96
R6791:Xpc UTSW 6 91506857 missense probably benign 0.01
R6794:Xpc UTSW 6 91506857 missense probably benign 0.01
R6983:Xpc UTSW 6 91504023 missense probably damaging 0.99
R7214:Xpc UTSW 6 91492338 missense probably damaging 1.00
R7524:Xpc UTSW 6 91499531 missense probably benign 0.23
R7581:Xpc UTSW 6 91498017 splice site probably benign
R8002:Xpc UTSW 6 91492305 missense probably damaging 0.98
R8992:Xpc UTSW 6 91500974 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AATGTCATGCCCCTTCCTGATG -3'
(R):5'- GGCTGATGACATATTCCTTCGC -3'

Sequencing Primer
(F):5'- TGATGCCAACTGACCACTTC -3'
(R):5'- TGCACTGCTATGTGTAGAAGCAC -3'
Posted On2019-10-07