Incidental Mutation 'R7442:Igf1r'
ID 577016
Institutional Source Beutler Lab
Gene Symbol Igf1r
Ensembl Gene ENSMUSG00000005533
Gene Name insulin-like growth factor I receptor
Synonyms IGF-1R, line 186, A330103N21Rik, hyft, CD221
MMRRC Submission 045518-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7442 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 67602575-67883416 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 67823026 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 385 (V385M)
Ref Sequence ENSEMBL: ENSMUSP00000005671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005671]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000005671
AA Change: V385M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: V385M

DomainStartEndE-ValueType
Pfam:Recep_L_domain 51 161 1.6e-29 PFAM
FU 227 270 2.98e-12 SMART
Pfam:Recep_L_domain 353 467 3.8e-32 PFAM
FN3 490 593 4.67e-2 SMART
FN3 612 815 1.95e-4 SMART
FN3 833 915 7.4e-5 SMART
low complexity region 937 954 N/A INTRINSIC
TyrKc 1000 1268 8.51e-141 SMART
low complexity region 1285 1303 N/A INTRINSIC
low complexity region 1306 1319 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,946,919 (GRCm39) I109T probably damaging Het
A430033K04Rik T C 5: 138,645,509 (GRCm39) S465P possibly damaging Het
Acap3 T C 4: 155,990,078 (GRCm39) F753L probably damaging Het
Adam9 A T 8: 25,457,223 (GRCm39) V635E probably damaging Het
Adgre4 T A 17: 56,159,340 (GRCm39) V675E probably benign Het
Anapc4 T C 5: 53,014,543 (GRCm39) Y469H probably benign Het
Ankdd1b T G 13: 96,561,268 (GRCm39) K325N possibly damaging Het
Aox1 T C 1: 58,121,172 (GRCm39) V881A probably damaging Het
Arhgap5 A G 12: 52,563,739 (GRCm39) T237A probably benign Het
Asah1 T C 8: 41,796,602 (GRCm39) D331G possibly damaging Het
Atp5f1a G A 18: 77,866,820 (GRCm39) R231H probably benign Het
Bod1l G A 5: 41,964,522 (GRCm39) P2694L probably damaging Het
Bst1 T C 5: 43,979,084 (GRCm39) S143P probably benign Het
Cacna1b A C 2: 24,497,513 (GRCm39) S2132A probably benign Het
Caps2 G T 10: 112,044,259 (GRCm39) R486L probably damaging Het
Ccdc168 A G 1: 44,097,868 (GRCm39) S1077P possibly damaging Het
Cd68 T C 11: 69,556,754 (GRCm39) T18A probably benign Het
Cdk8 T C 5: 146,229,579 (GRCm39) probably null Het
Col18a1 A T 10: 76,932,072 (GRCm39) I127N unknown Het
Dsc3 T C 18: 20,114,213 (GRCm39) D347G probably damaging Het
Dyrk2 T C 10: 118,695,786 (GRCm39) S491G probably damaging Het
Edem1 T A 6: 108,828,266 (GRCm39) Y530* probably null Het
Enc1 A T 13: 97,383,248 (GRCm39) H586L probably benign Het
Ephb6 T G 6: 41,594,981 (GRCm39) probably null Het
Etv5 G T 16: 22,254,809 (GRCm39) Q48K probably damaging Het
Exoc3l A G 8: 106,019,558 (GRCm39) W404R probably damaging Het
Fbn1 C A 2: 125,245,132 (GRCm39) A252S possibly damaging Het
Foxe3 A G 4: 114,782,490 (GRCm39) S241P unknown Het
Gm49380 T A 9: 44,023,709 (GRCm39) M180L probably benign Het
Hoxd1 A T 2: 74,593,903 (GRCm39) D153V probably damaging Het
Ifi207 C T 1: 173,554,997 (GRCm39) S895N probably benign Het
Ints9 C T 14: 65,232,513 (GRCm39) Q191* probably null Het
Ktn1 A G 14: 47,952,097 (GRCm39) E979G probably benign Het
Lama3 G A 18: 12,605,238 (GRCm39) probably null Het
Lrtm2 C T 6: 119,294,392 (GRCm39) M246I probably damaging Het
Mdm1 T C 10: 117,982,590 (GRCm39) V75A probably benign Het
Mia3 T C 1: 183,140,220 (GRCm39) E165G probably benign Het
Mrps21 T C 3: 95,770,128 (GRCm39) E67G probably damaging Het
Mybpc1 A C 10: 88,362,155 (GRCm39) I995S probably damaging Het
Mylk2 T G 2: 152,753,346 (GRCm39) probably benign Het
Myo16 G A 8: 10,322,537 (GRCm39) C11Y probably damaging Het
Nudt18 A C 14: 70,816,798 (GRCm39) D134A probably benign Het
Obox1 G T 7: 15,289,491 (GRCm39) K93N probably benign Het
Or12d2 T A 17: 37,624,816 (GRCm39) H153L possibly damaging Het
Or2r3 A T 6: 42,448,434 (GRCm39) M226K probably benign Het
Or56a4 T C 7: 104,806,289 (GRCm39) Y200C probably damaging Het
Or5ar1 A T 2: 85,672,096 (GRCm39) V13D probably benign Het
Pkd2l1 T C 19: 44,145,668 (GRCm39) H185R probably benign Het
Ptpn18 A G 1: 34,501,831 (GRCm39) T48A probably benign Het
Ptprd A T 4: 75,978,058 (GRCm39) Y583* probably null Het
Ptprk G A 10: 28,450,815 (GRCm39) G992D probably damaging Het
Setdb2 A G 14: 59,656,700 (GRCm39) F206L probably damaging Het
Slain1 A G 14: 103,923,150 (GRCm39) D247G probably damaging Het
Slc10a2 A T 8: 5,139,086 (GRCm39) V286E possibly damaging Het
Slc44a2 C T 9: 21,256,819 (GRCm39) T367I probably damaging Het
Slco4a1 T C 2: 180,115,919 (GRCm39) V685A probably benign Het
Srp54c T A 12: 55,302,347 (GRCm39) Y333N probably damaging Het
Srrm2 T C 17: 24,039,091 (GRCm39) S1912P unknown Het
St7l A G 3: 104,796,645 (GRCm39) T253A possibly damaging Het
Styxl2 T C 1: 165,928,584 (GRCm39) K343E probably benign Het
Sun3 T G 11: 8,981,445 (GRCm39) Y53S possibly damaging Het
Tktl2 A G 8: 66,965,561 (GRCm39) N373S possibly damaging Het
Tmco3 T A 8: 13,370,781 (GRCm39) S648R probably damaging Het
Tmem178 T A 17: 81,252,185 (GRCm39) V23D probably damaging Het
Tmem229a C A 6: 24,955,689 (GRCm39) G22W probably damaging Het
Top3a C T 11: 60,644,744 (GRCm39) S320N possibly damaging Het
Treml1 C A 17: 48,673,719 (GRCm39) D243E probably damaging Het
Trim42 C T 9: 97,244,998 (GRCm39) V601M probably damaging Het
Ttn A G 2: 76,573,350 (GRCm39) S25848P probably damaging Het
Vmn1r86 A T 7: 12,835,983 (GRCm39) F298I possibly damaging Het
Vmn2r96 T C 17: 18,793,662 (GRCm39) F2S probably benign Het
Xpc A G 6: 91,481,631 (GRCm39) L230P probably damaging Het
Xpo4 A G 14: 57,867,680 (GRCm39) V189A probably benign Het
Zfhx3 A G 8: 109,519,468 (GRCm39) T197A probably damaging Het
Zswim1 A G 2: 164,667,710 (GRCm39) K321E probably damaging Het
Other mutations in Igf1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Igf1r APN 7 67,839,771 (GRCm39) missense probably benign
IGL00837:Igf1r APN 7 67,851,100 (GRCm39) splice site probably benign
IGL01515:Igf1r APN 7 67,857,200 (GRCm39) missense probably damaging 1.00
IGL01572:Igf1r APN 7 67,843,189 (GRCm39) missense probably benign 0.01
IGL02100:Igf1r APN 7 67,839,706 (GRCm39) missense probably benign 0.05
IGL02506:Igf1r APN 7 67,843,144 (GRCm39) missense probably benign
IGL02672:Igf1r APN 7 67,839,781 (GRCm39) missense probably benign 0.05
IGL02701:Igf1r APN 7 67,850,997 (GRCm39) missense possibly damaging 0.93
IGL02742:Igf1r APN 7 67,839,739 (GRCm39) missense possibly damaging 0.94
IGL03073:Igf1r APN 7 67,864,791 (GRCm39) missense probably damaging 1.00
IGL03257:Igf1r APN 7 67,864,688 (GRCm39) missense probably damaging 1.00
Frufru UTSW 7 67,653,911 (GRCm39) missense probably damaging 1.00
Hungarian UTSW 7 67,864,745 (GRCm39) missense probably damaging 1.00
Mimi UTSW 7 67,844,774 (GRCm39) missense possibly damaging 0.67
Piroshka UTSW 7 67,857,084 (GRCm39) nonsense probably null
Romanian UTSW 7 67,653,885 (GRCm39) missense possibly damaging 0.94
Sublime UTSW 7 67,653,927 (GRCm39) missense probably damaging 1.00
Toy UTSW 7 67,653,720 (GRCm39) missense probably damaging 1.00
BB009:Igf1r UTSW 7 67,861,802 (GRCm39) missense possibly damaging 0.88
BB019:Igf1r UTSW 7 67,861,802 (GRCm39) missense possibly damaging 0.88
FR4548:Igf1r UTSW 7 67,875,934 (GRCm39) small insertion probably benign
FR4737:Igf1r UTSW 7 67,875,929 (GRCm39) small insertion probably benign
FR4976:Igf1r UTSW 7 67,875,934 (GRCm39) small insertion probably benign
FR4976:Igf1r UTSW 7 67,875,929 (GRCm39) small insertion probably benign
PIT4445001:Igf1r UTSW 7 67,857,211 (GRCm39) missense probably damaging 1.00
R0003:Igf1r UTSW 7 67,814,990 (GRCm39) missense probably damaging 1.00
R0184:Igf1r UTSW 7 67,875,941 (GRCm39) missense possibly damaging 0.84
R0538:Igf1r UTSW 7 67,857,574 (GRCm39) missense probably damaging 1.00
R0632:Igf1r UTSW 7 67,814,903 (GRCm39) missense probably damaging 1.00
R0727:Igf1r UTSW 7 67,861,906 (GRCm39) critical splice donor site probably null
R0750:Igf1r UTSW 7 67,861,839 (GRCm39) missense probably damaging 0.99
R1104:Igf1r UTSW 7 67,844,774 (GRCm39) missense possibly damaging 0.67
R1169:Igf1r UTSW 7 67,814,875 (GRCm39) missense probably benign 0.00
R1348:Igf1r UTSW 7 67,868,216 (GRCm39) missense probably damaging 1.00
R1471:Igf1r UTSW 7 67,653,585 (GRCm39) missense probably damaging 0.98
R1580:Igf1r UTSW 7 67,857,617 (GRCm39) missense probably benign
R1745:Igf1r UTSW 7 67,819,661 (GRCm39) missense probably damaging 1.00
R1772:Igf1r UTSW 7 67,844,822 (GRCm39) missense probably benign 0.03
R1789:Igf1r UTSW 7 67,864,681 (GRCm39) nonsense probably null
R1823:Igf1r UTSW 7 67,844,729 (GRCm39) missense possibly damaging 0.77
R1902:Igf1r UTSW 7 67,850,997 (GRCm39) missense possibly damaging 0.93
R1962:Igf1r UTSW 7 67,857,023 (GRCm39) missense probably damaging 0.99
R2179:Igf1r UTSW 7 67,653,698 (GRCm39) missense probably damaging 0.99
R2215:Igf1r UTSW 7 67,814,982 (GRCm39) missense probably benign
R2221:Igf1r UTSW 7 67,851,710 (GRCm39) missense probably damaging 1.00
R2233:Igf1r UTSW 7 67,861,828 (GRCm39) missense probably damaging 1.00
R2234:Igf1r UTSW 7 67,861,828 (GRCm39) missense probably damaging 1.00
R2235:Igf1r UTSW 7 67,861,828 (GRCm39) missense probably damaging 1.00
R3023:Igf1r UTSW 7 67,833,147 (GRCm39) missense probably benign 0.00
R4044:Igf1r UTSW 7 67,839,810 (GRCm39) missense possibly damaging 0.83
R4226:Igf1r UTSW 7 67,844,826 (GRCm39) nonsense probably null
R4387:Igf1r UTSW 7 67,819,757 (GRCm39) missense probably benign
R4388:Igf1r UTSW 7 67,819,757 (GRCm39) missense probably benign
R4728:Igf1r UTSW 7 67,839,372 (GRCm39) missense probably damaging 1.00
R4781:Igf1r UTSW 7 67,814,947 (GRCm39) missense possibly damaging 0.75
R5254:Igf1r UTSW 7 67,857,067 (GRCm39) missense probably damaging 0.99
R5278:Igf1r UTSW 7 67,843,166 (GRCm39) missense possibly damaging 0.78
R5510:Igf1r UTSW 7 67,843,107 (GRCm39) missense probably benign 0.19
R5522:Igf1r UTSW 7 67,833,258 (GRCm39) missense probably damaging 0.96
R5527:Igf1r UTSW 7 67,857,569 (GRCm39) missense probably damaging 1.00
R5761:Igf1r UTSW 7 67,857,001 (GRCm39) missense probably damaging 1.00
R5849:Igf1r UTSW 7 67,839,781 (GRCm39) missense probably benign
R6189:Igf1r UTSW 7 67,857,084 (GRCm39) nonsense probably null
R6262:Igf1r UTSW 7 67,653,720 (GRCm39) missense probably damaging 1.00
R6285:Igf1r UTSW 7 67,653,885 (GRCm39) missense possibly damaging 0.94
R6318:Igf1r UTSW 7 67,814,981 (GRCm39) missense probably benign 0.02
R6365:Igf1r UTSW 7 67,839,798 (GRCm39) missense probably benign 0.26
R6377:Igf1r UTSW 7 67,850,998 (GRCm39) missense probably benign 0.00
R6831:Igf1r UTSW 7 67,857,067 (GRCm39) missense possibly damaging 0.75
R6848:Igf1r UTSW 7 67,653,927 (GRCm39) missense probably damaging 1.00
R6902:Igf1r UTSW 7 67,653,911 (GRCm39) missense probably damaging 1.00
R7193:Igf1r UTSW 7 67,836,905 (GRCm39) missense probably damaging 1.00
R7373:Igf1r UTSW 7 67,844,826 (GRCm39) nonsense probably null
R7903:Igf1r UTSW 7 67,834,500 (GRCm39) missense probably damaging 1.00
R7923:Igf1r UTSW 7 67,839,849 (GRCm39) missense probably damaging 1.00
R7932:Igf1r UTSW 7 67,861,802 (GRCm39) missense possibly damaging 0.88
R8368:Igf1r UTSW 7 67,836,796 (GRCm39) missense probably benign 0.03
R8458:Igf1r UTSW 7 67,845,377 (GRCm39) missense probably benign
R8539:Igf1r UTSW 7 67,653,596 (GRCm39) missense probably benign 0.06
R8704:Igf1r UTSW 7 67,819,802 (GRCm39) splice site probably benign
R8746:Igf1r UTSW 7 67,864,745 (GRCm39) missense probably damaging 1.00
R8829:Igf1r UTSW 7 67,875,769 (GRCm39) missense probably damaging 1.00
R8832:Igf1r UTSW 7 67,875,769 (GRCm39) missense probably damaging 1.00
R8859:Igf1r UTSW 7 67,833,211 (GRCm39) missense possibly damaging 0.75
R9057:Igf1r UTSW 7 67,833,186 (GRCm39) missense probably damaging 1.00
R9243:Igf1r UTSW 7 67,861,775 (GRCm39) missense probably benign 0.11
R9342:Igf1r UTSW 7 67,844,746 (GRCm39) missense probably benign 0.00
R9412:Igf1r UTSW 7 67,857,001 (GRCm39) missense probably damaging 1.00
R9525:Igf1r UTSW 7 67,864,682 (GRCm39) missense probably damaging 1.00
R9727:Igf1r UTSW 7 67,857,554 (GRCm39) missense probably damaging 1.00
R9730:Igf1r UTSW 7 67,839,423 (GRCm39) missense probably damaging 1.00
R9779:Igf1r UTSW 7 67,654,065 (GRCm39) missense probably damaging 1.00
RF025:Igf1r UTSW 7 67,875,927 (GRCm39) small insertion probably benign
RF032:Igf1r UTSW 7 67,875,927 (GRCm39) small insertion probably benign
RF034:Igf1r UTSW 7 67,875,924 (GRCm39) small insertion probably benign
RF037:Igf1r UTSW 7 67,875,924 (GRCm39) small insertion probably benign
RF039:Igf1r UTSW 7 67,875,924 (GRCm39) small insertion probably benign
RF044:Igf1r UTSW 7 67,875,927 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,916 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,930 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,928 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,922 (GRCm39) small insertion probably benign
Z1186:Igf1r UTSW 7 67,875,917 (GRCm39) small insertion probably benign
Z1191:Igf1r UTSW 7 67,875,918 (GRCm39) small insertion probably benign
Z1191:Igf1r UTSW 7 67,875,917 (GRCm39) small insertion probably benign
Z1191:Igf1r UTSW 7 67,875,921 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TAGAAGTCTGCTTTCCCGCC -3'
(R):5'- TCTGCGTAACAAACCCAAGG -3'

Sequencing Primer
(F):5'- ACGGTTGGTGCTATGCCAG -3'
(R):5'- GAGACTGACTCCCACAAGTTGTATTC -3'
Posted On 2019-10-07