Incidental Mutation 'R7442:Asah1'
ID 577022
Institutional Source Beutler Lab
Gene Symbol Asah1
Ensembl Gene ENSMUSG00000031591
Gene Name N-acylsphingosine amidohydrolase 1
Synonyms acid ceramidase, 2310081N20Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7442 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 41340197-41374773 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 41343565 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 331 (D331G)
Ref Sequence ENSEMBL: ENSMUSP00000034000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034000] [ENSMUST00000110417]
AlphaFold Q9WV54
Predicted Effect possibly damaging
Transcript: ENSMUST00000034000
AA Change: D331G

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000034000
Gene: ENSMUSG00000031591
AA Change: D331G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:NAAA-beta 44 138 4.2e-35 PFAM
Pfam:CBAH 142 389 1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110417
SMART Domains Protein: ENSMUSP00000106047
Gene: ENSMUSG00000031591

DomainStartEndE-ValueType
Pfam:NAAA-beta 24 118 8.8e-39 PFAM
Pfam:CBAH 122 216 7.9e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: This gene encodes acid ceramidase, an enzyme that plays a central role in ceramide metabolism. The encoded protein undergoes proteolytic processing to generate a heterodimeric enzyme comprised of alpha and beta subunits that catalyzes the hydrolysis of sphingolipid ceramide into sphingosine and free fatty acid. The homozygous disruption of this gene leads to embryonic lethality in mice whereas the heterozygous animals exhibit a progressive lipid storage disease phenotype. [provided by RefSeq, Oct 2015]
PHENOTYPE: Nullizygous mutation of this gene causes embryonic lethality. Homozygotes for the P361R mutation die prematurely with growth defects, low acid ceramidase activity, high ceramide levels, histiocyte infiltrates into various organs, Farber bodies, short femur growth plates and altered ovary morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,220,290 I109T probably damaging Het
A430033K04Rik T C 5: 138,647,247 S465P possibly damaging Het
Acap3 T C 4: 155,905,621 F753L probably damaging Het
Adam9 A T 8: 24,967,207 V635E probably damaging Het
Adgre4 T A 17: 55,852,340 V675E probably benign Het
Anapc4 T C 5: 52,857,201 Y469H probably benign Het
Ankdd1b T G 13: 96,424,760 K325N possibly damaging Het
Aox1 T C 1: 58,082,013 V881A probably damaging Het
Arhgap5 A G 12: 52,516,956 T237A probably benign Het
Atp5a1 G A 18: 77,779,120 R231H probably benign Het
Bod1l G A 5: 41,807,179 P2694L probably damaging Het
Bst1 T C 5: 43,821,742 S143P probably benign Het
Cacna1b A C 2: 24,607,501 S2132A probably benign Het
Caps2 G T 10: 112,208,354 R486L probably damaging Het
Cd68 T C 11: 69,665,928 T18A probably benign Het
Cdk8 T C 5: 146,292,769 probably null Het
Col18a1 A T 10: 77,096,238 I127N unknown Het
Dsc3 T C 18: 19,981,156 D347G probably damaging Het
Dusp27 T C 1: 166,101,015 K343E probably benign Het
Dyrk2 T C 10: 118,859,881 S491G probably damaging Het
Edem1 T A 6: 108,851,305 Y530* probably null Het
Enc1 A T 13: 97,246,740 H586L probably benign Het
Ephb6 T G 6: 41,618,047 probably null Het
Etv5 G T 16: 22,436,059 Q48K probably damaging Het
Exoc3l A G 8: 105,292,926 W404R probably damaging Het
Fbn1 C A 2: 125,403,212 A252S possibly damaging Het
Foxe3 A G 4: 114,925,293 S241P unknown Het
Gm49380 T A 9: 44,112,412 M180L probably benign Het
Gm8251 A G 1: 44,058,708 S1077P possibly damaging Het
Hoxd1 A T 2: 74,763,559 D153V probably damaging Het
Ifi207 C T 1: 173,727,431 S895N probably benign Het
Igf1r G A 7: 68,173,278 V385M probably damaging Het
Ints9 C T 14: 64,995,064 Q191* probably null Het
Ktn1 A G 14: 47,714,640 E979G probably benign Het
Lama3 G A 18: 12,472,181 probably null Het
Lrtm2 C T 6: 119,317,431 M246I probably damaging Het
Mdm1 T C 10: 118,146,685 V75A probably benign Het
Mia3 T C 1: 183,358,876 E165G probably benign Het
Mrps21 T C 3: 95,862,816 E67G probably damaging Het
Mybpc1 A C 10: 88,526,293 I995S probably damaging Het
Mylk2 T G 2: 152,911,426 probably benign Het
Myo16 G A 8: 10,272,537 C11Y probably damaging Het
Nudt18 A C 14: 70,579,358 D134A probably benign Het
Obox1 G T 7: 15,555,566 K93N probably benign Het
Olfr1019 A T 2: 85,841,752 V13D probably benign Het
Olfr102 T A 17: 37,313,925 H153L possibly damaging Het
Olfr457 A T 6: 42,471,500 M226K probably benign Het
Olfr684 T C 7: 105,157,082 Y200C probably damaging Het
Pkd2l1 T C 19: 44,157,229 H185R probably benign Het
Ptpn18 A G 1: 34,462,750 T48A probably benign Het
Ptprd A T 4: 76,059,821 Y583* probably null Het
Ptprk G A 10: 28,574,819 G992D probably damaging Het
Setdb2 A G 14: 59,419,251 F206L probably damaging Het
Slain1 A G 14: 103,685,714 D247G probably damaging Het
Slc10a2 A T 8: 5,089,086 V286E possibly damaging Het
Slc44a2 C T 9: 21,345,523 T367I probably damaging Het
Slco4a1 T C 2: 180,474,126 V685A probably benign Het
Srp54c T A 12: 55,255,562 Y333N probably damaging Het
Srrm2 T C 17: 23,820,117 S1912P unknown Het
St7l A G 3: 104,889,329 T253A possibly damaging Het
Sun3 T G 11: 9,031,445 Y53S possibly damaging Het
Tktl2 A G 8: 66,512,909 N373S possibly damaging Het
Tmco3 T A 8: 13,320,781 S648R probably damaging Het
Tmem178 T A 17: 80,944,756 V23D probably damaging Het
Tmem229a C A 6: 24,955,690 G22W probably damaging Het
Top3a C T 11: 60,753,918 S320N possibly damaging Het
Treml1 C A 17: 48,366,691 D243E probably damaging Het
Trim42 C T 9: 97,362,945 V601M probably damaging Het
Ttn A G 2: 76,743,006 S25848P probably damaging Het
Vmn1r86 A T 7: 13,102,056 F298I possibly damaging Het
Vmn2r96 T C 17: 18,573,400 F2S probably benign Het
Xpc A G 6: 91,504,649 L230P probably damaging Het
Xpo4 A G 14: 57,630,223 V189A probably benign Het
Zfhx3 A G 8: 108,792,836 T197A probably damaging Het
Zswim1 A G 2: 164,825,790 K321E probably damaging Het
Other mutations in Asah1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01824:Asah1 APN 8 41349543 unclassified probably benign
IGL02512:Asah1 APN 8 41360307 intron probably benign
IGL02523:Asah1 APN 8 41351947 missense probably benign
IGL03115:Asah1 APN 8 41360299 missense possibly damaging 0.94
IGL03357:Asah1 APN 8 41346196 splice site probably benign
PIT4366001:Asah1 UTSW 8 41343746 missense possibly damaging 0.94
R0593:Asah1 UTSW 8 41349582 missense probably benign 0.02
R1451:Asah1 UTSW 8 41354012 critical splice donor site probably null
R1977:Asah1 UTSW 8 41343517 critical splice donor site probably null
R2200:Asah1 UTSW 8 41343728 critical splice donor site probably null
R3429:Asah1 UTSW 8 41351888 unclassified probably benign
R4002:Asah1 UTSW 8 41348139 splice site probably benign
R4078:Asah1 UTSW 8 41354082 missense probably damaging 0.99
R4470:Asah1 UTSW 8 41343724 splice site probably null
R4471:Asah1 UTSW 8 41343724 splice site probably null
R4968:Asah1 UTSW 8 41354030 missense
R4970:Asah1 UTSW 8 41360277 nonsense probably null
R5643:Asah1 UTSW 8 41360295 missense possibly damaging 0.94
R5644:Asah1 UTSW 8 41360295 missense possibly damaging 0.94
R6128:Asah1 UTSW 8 41354055 missense probably damaging 1.00
R6419:Asah1 UTSW 8 41343766 missense probably damaging 1.00
R7059:Asah1 UTSW 8 41347069 missense probably damaging 0.96
R7587:Asah1 UTSW 8 41374541 missense probably benign 0.43
R7663:Asah1 UTSW 8 41341627 missense probably damaging 0.98
R7980:Asah1 UTSW 8 41354030 missense
R8122:Asah1 UTSW 8 41343730 missense probably benign 0.01
R8275:Asah1 UTSW 8 41348122 missense probably damaging 1.00
R8700:Asah1 UTSW 8 41360275 missense probably benign 0.03
R8752:Asah1 UTSW 8 41360277 missense possibly damaging 0.47
R8960:Asah1 UTSW 8 41347024 missense probably damaging 1.00
R9131:Asah1 UTSW 8 41354012 critical splice donor site probably null
R9539:Asah1 UTSW 8 41374547 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCCATACCGTGTGTCAAGAG -3'
(R):5'- TTATCCTGGGAGGCAAGAAGTC -3'

Sequencing Primer
(F):5'- GAGAGAAATAGGTTTGCAGATTTCTC -3'
(R):5'- GAAAAGAGTCTTTGGATGTCTATGAG -3'
Posted On 2019-10-07