Incidental Mutation 'R7442:Exoc3l'
ID 577025
Institutional Source Beutler Lab
Gene Symbol Exoc3l
Ensembl Gene ENSMUSG00000043251
Gene Name exocyst complex component 3-like
Synonyms C730015A04Rik
MMRRC Submission 045518-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.248) question?
Stock # R7442 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 106016556-106022733 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106019558 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 404 (W404R)
Ref Sequence ENSEMBL: ENSMUSP00000053766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014981] [ENSMUST00000015003] [ENSMUST00000057855] [ENSMUST00000171788] [ENSMUST00000212219] [ENSMUST00000212777] [ENSMUST00000212922]
AlphaFold Q8BI71
Predicted Effect probably benign
Transcript: ENSMUST00000014981
SMART Domains Protein: ENSMUSP00000014981
Gene: ENSMUSG00000014837

DomainStartEndE-ValueType
DUF1704 148 457 1.07e-139 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000015003
SMART Domains Protein: ENSMUSP00000015003
Gene: ENSMUSG00000014859

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
E2F_TDP 17 83 3.56e-31 SMART
Pfam:E2F_CC-MB 100 196 2.8e-36 PFAM
low complexity region 201 252 N/A INTRINSIC
low complexity region 360 372 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000057855
AA Change: W404R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053766
Gene: ENSMUSG00000043251
AA Change: W404R

DomainStartEndE-ValueType
Pfam:Sec6 189 722 5.4e-116 PFAM
low complexity region 723 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171788
SMART Domains Protein: ENSMUSP00000128530
Gene: ENSMUSG00000014837

DomainStartEndE-ValueType
DUF1704 148 457 1.07e-139 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212219
Predicted Effect probably benign
Transcript: ENSMUST00000212777
Predicted Effect probably benign
Transcript: ENSMUST00000212922
Meta Mutation Damage Score 0.8265 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (76/76)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A G 8: 79,946,919 (GRCm39) I109T probably damaging Het
A430033K04Rik T C 5: 138,645,509 (GRCm39) S465P possibly damaging Het
Acap3 T C 4: 155,990,078 (GRCm39) F753L probably damaging Het
Adam9 A T 8: 25,457,223 (GRCm39) V635E probably damaging Het
Adgre4 T A 17: 56,159,340 (GRCm39) V675E probably benign Het
Anapc4 T C 5: 53,014,543 (GRCm39) Y469H probably benign Het
Ankdd1b T G 13: 96,561,268 (GRCm39) K325N possibly damaging Het
Aox1 T C 1: 58,121,172 (GRCm39) V881A probably damaging Het
Arhgap5 A G 12: 52,563,739 (GRCm39) T237A probably benign Het
Asah1 T C 8: 41,796,602 (GRCm39) D331G possibly damaging Het
Atp5f1a G A 18: 77,866,820 (GRCm39) R231H probably benign Het
Bod1l G A 5: 41,964,522 (GRCm39) P2694L probably damaging Het
Bst1 T C 5: 43,979,084 (GRCm39) S143P probably benign Het
Cacna1b A C 2: 24,497,513 (GRCm39) S2132A probably benign Het
Caps2 G T 10: 112,044,259 (GRCm39) R486L probably damaging Het
Ccdc168 A G 1: 44,097,868 (GRCm39) S1077P possibly damaging Het
Cd68 T C 11: 69,556,754 (GRCm39) T18A probably benign Het
Cdk8 T C 5: 146,229,579 (GRCm39) probably null Het
Col18a1 A T 10: 76,932,072 (GRCm39) I127N unknown Het
Dsc3 T C 18: 20,114,213 (GRCm39) D347G probably damaging Het
Dyrk2 T C 10: 118,695,786 (GRCm39) S491G probably damaging Het
Edem1 T A 6: 108,828,266 (GRCm39) Y530* probably null Het
Enc1 A T 13: 97,383,248 (GRCm39) H586L probably benign Het
Ephb6 T G 6: 41,594,981 (GRCm39) probably null Het
Etv5 G T 16: 22,254,809 (GRCm39) Q48K probably damaging Het
Fbn1 C A 2: 125,245,132 (GRCm39) A252S possibly damaging Het
Foxe3 A G 4: 114,782,490 (GRCm39) S241P unknown Het
Gm49380 T A 9: 44,023,709 (GRCm39) M180L probably benign Het
Hoxd1 A T 2: 74,593,903 (GRCm39) D153V probably damaging Het
Ifi207 C T 1: 173,554,997 (GRCm39) S895N probably benign Het
Igf1r G A 7: 67,823,026 (GRCm39) V385M probably damaging Het
Ints9 C T 14: 65,232,513 (GRCm39) Q191* probably null Het
Ktn1 A G 14: 47,952,097 (GRCm39) E979G probably benign Het
Lama3 G A 18: 12,605,238 (GRCm39) probably null Het
Lrtm2 C T 6: 119,294,392 (GRCm39) M246I probably damaging Het
Mdm1 T C 10: 117,982,590 (GRCm39) V75A probably benign Het
Mia3 T C 1: 183,140,220 (GRCm39) E165G probably benign Het
Mrps21 T C 3: 95,770,128 (GRCm39) E67G probably damaging Het
Mybpc1 A C 10: 88,362,155 (GRCm39) I995S probably damaging Het
Mylk2 T G 2: 152,753,346 (GRCm39) probably benign Het
Myo16 G A 8: 10,322,537 (GRCm39) C11Y probably damaging Het
Nudt18 A C 14: 70,816,798 (GRCm39) D134A probably benign Het
Obox1 G T 7: 15,289,491 (GRCm39) K93N probably benign Het
Or12d2 T A 17: 37,624,816 (GRCm39) H153L possibly damaging Het
Or2r3 A T 6: 42,448,434 (GRCm39) M226K probably benign Het
Or56a4 T C 7: 104,806,289 (GRCm39) Y200C probably damaging Het
Or5ar1 A T 2: 85,672,096 (GRCm39) V13D probably benign Het
Pkd2l1 T C 19: 44,145,668 (GRCm39) H185R probably benign Het
Ptpn18 A G 1: 34,501,831 (GRCm39) T48A probably benign Het
Ptprd A T 4: 75,978,058 (GRCm39) Y583* probably null Het
Ptprk G A 10: 28,450,815 (GRCm39) G992D probably damaging Het
Setdb2 A G 14: 59,656,700 (GRCm39) F206L probably damaging Het
Slain1 A G 14: 103,923,150 (GRCm39) D247G probably damaging Het
Slc10a2 A T 8: 5,139,086 (GRCm39) V286E possibly damaging Het
Slc44a2 C T 9: 21,256,819 (GRCm39) T367I probably damaging Het
Slco4a1 T C 2: 180,115,919 (GRCm39) V685A probably benign Het
Srp54c T A 12: 55,302,347 (GRCm39) Y333N probably damaging Het
Srrm2 T C 17: 24,039,091 (GRCm39) S1912P unknown Het
St7l A G 3: 104,796,645 (GRCm39) T253A possibly damaging Het
Styxl2 T C 1: 165,928,584 (GRCm39) K343E probably benign Het
Sun3 T G 11: 8,981,445 (GRCm39) Y53S possibly damaging Het
Tktl2 A G 8: 66,965,561 (GRCm39) N373S possibly damaging Het
Tmco3 T A 8: 13,370,781 (GRCm39) S648R probably damaging Het
Tmem178 T A 17: 81,252,185 (GRCm39) V23D probably damaging Het
Tmem229a C A 6: 24,955,689 (GRCm39) G22W probably damaging Het
Top3a C T 11: 60,644,744 (GRCm39) S320N possibly damaging Het
Treml1 C A 17: 48,673,719 (GRCm39) D243E probably damaging Het
Trim42 C T 9: 97,244,998 (GRCm39) V601M probably damaging Het
Ttn A G 2: 76,573,350 (GRCm39) S25848P probably damaging Het
Vmn1r86 A T 7: 12,835,983 (GRCm39) F298I possibly damaging Het
Vmn2r96 T C 17: 18,793,662 (GRCm39) F2S probably benign Het
Xpc A G 6: 91,481,631 (GRCm39) L230P probably damaging Het
Xpo4 A G 14: 57,867,680 (GRCm39) V189A probably benign Het
Zfhx3 A G 8: 109,519,468 (GRCm39) T197A probably damaging Het
Zswim1 A G 2: 164,667,710 (GRCm39) K321E probably damaging Het
Other mutations in Exoc3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Exoc3l APN 8 106,017,130 (GRCm39) missense probably benign 0.25
IGL01731:Exoc3l APN 8 106,019,587 (GRCm39) missense probably benign 0.16
IGL02364:Exoc3l APN 8 106,017,209 (GRCm39) missense possibly damaging 0.71
IGL02413:Exoc3l APN 8 106,019,070 (GRCm39) missense probably damaging 1.00
IGL02512:Exoc3l APN 8 106,017,115 (GRCm39) missense probably damaging 1.00
IGL02810:Exoc3l APN 8 106,021,980 (GRCm39) missense probably damaging 1.00
R0045:Exoc3l UTSW 8 106,020,317 (GRCm39) missense probably damaging 1.00
R0045:Exoc3l UTSW 8 106,020,317 (GRCm39) missense probably damaging 1.00
R0183:Exoc3l UTSW 8 106,021,932 (GRCm39) missense probably damaging 1.00
R0302:Exoc3l UTSW 8 106,020,175 (GRCm39) missense probably benign 0.01
R1660:Exoc3l UTSW 8 106,019,692 (GRCm39) critical splice donor site probably null
R1699:Exoc3l UTSW 8 106,021,645 (GRCm39) missense probably benign 0.34
R1826:Exoc3l UTSW 8 106,020,250 (GRCm39) missense probably damaging 0.97
R2275:Exoc3l UTSW 8 106,017,079 (GRCm39) critical splice donor site probably null
R3928:Exoc3l UTSW 8 106,017,549 (GRCm39) unclassified probably benign
R3938:Exoc3l UTSW 8 106,020,037 (GRCm39) missense probably damaging 1.00
R4261:Exoc3l UTSW 8 106,017,599 (GRCm39) missense probably damaging 0.98
R4273:Exoc3l UTSW 8 106,016,593 (GRCm39) makesense probably null
R5518:Exoc3l UTSW 8 106,019,795 (GRCm39) missense probably benign 0.27
R6471:Exoc3l UTSW 8 106,017,166 (GRCm39) missense probably damaging 1.00
R6511:Exoc3l UTSW 8 106,019,887 (GRCm39) missense probably benign 0.00
R6631:Exoc3l UTSW 8 106,021,993 (GRCm39) missense probably damaging 1.00
R6694:Exoc3l UTSW 8 106,017,122 (GRCm39) missense probably benign 0.15
R6843:Exoc3l UTSW 8 106,016,729 (GRCm39) missense probably benign 0.00
R7310:Exoc3l UTSW 8 106,020,340 (GRCm39) missense probably damaging 1.00
R7387:Exoc3l UTSW 8 106,021,605 (GRCm39) missense probably damaging 1.00
R7764:Exoc3l UTSW 8 106,017,333 (GRCm39) missense possibly damaging 0.62
R7845:Exoc3l UTSW 8 106,016,782 (GRCm39) missense probably damaging 1.00
R8748:Exoc3l UTSW 8 106,016,777 (GRCm39) missense probably damaging 0.98
R8879:Exoc3l UTSW 8 106,017,181 (GRCm39) missense
Z1176:Exoc3l UTSW 8 106,017,426 (GRCm39) missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TCAGCCAGGATCTACAAGCAG -3'
(R):5'- TGATGTGTCCCAGCTAGAGC -3'

Sequencing Primer
(F):5'- CCAGGATCTACAAGCAGGGAGG -3'
(R):5'- TCTTGACCTCAGAGAACATTGAGCAG -3'
Posted On 2019-10-07